Gene Ontology annotation through association of InterPro records with GO terms.
Annotation inferences using phylogenetic trees
AutomaticComplete:UniProtKB-SubCell
Electronic Gene Ontology annotations created by ARBA machine learning models
Combined automated annotation using Multiple IEA Methods.
Subcellular localization predictions from SUBA
cDNA and derived amino acid sequence of a cytosolic Cu,Zn superoxide dismutase from Arabidopsis thaliana (L.) Heyhn.
Superoxide dismutase in Arabidopsis: an eclectic enzyme family with disparate regulation and protein localization.
-
CSD1 is the 15-kDa cytosolic Cu/Zn superoxide dismutase in Arabidopsis and both its mRNA and protein are induced by ozone, UV-B irradiation, and increased light fluence.
"Additionally, we showed that the mRNA and protein for CSD1 are induced in response to UV-B illumination and to growth under increasing light fluences (Figs. 9 and 11 )."
A custom microarray analysis of gene expression during programmed cell death in Arabidopsis thaliana.
-
Oxidative stress-related genes including CSD1 are upregulated during plant programmed cell death.
"We show that certain oxidative stress-related genes, including CSD1, CSD3, and GPX, in addition to cysteine proteinases, some transcription factors, and HR-related genes may serve as markers of a core plant cell death programme."
Two P-type ATPases are required for copper delivery in Arabidopsis thaliana chloroplasts.
-
CSD1 encodes the cytosolic Cu/ZnSOD in Arabidopsis whose expression and activity increase with copper feeding.
"CSD1 encodes a Cu/ZnSOD active in the cytosol, and CSD2 encodes a Cu/ZnSOD active in the chloroplast stroma."
Posttranscriptional induction of two Cu/Zn superoxide dismutase genes in Arabidopsis is mediated by downregulation of miR398 and important for oxidative stress tolerance.
-
miR398 directs cleavage and degradation of CSD1 and CSD2 mRNAs; oxidative stresses downregulate miR398 to allow post-transcriptional CSD1 and CSD2 mRNA accumulation.
"Here, we show that miR398 expression is downregulated transcriptionally by oxidative stresses, and this downregulation is important for posttranscriptional CSD1 and CSD2 mRNA accumulation and oxidative stress tolerance."
Long-term effects of mild salt stress on growth, ion accumulation and superoxide dismutase expression of Arabidopsis rosette leaves.
-
Salt stress strongly stimulates CSD1 transcript expression in Col-0 rosette leaves.
"In Col, salt treatments inhibited the expression of FSD1 and strongly stimulated that of CSD1 and MSD."
Sucrose induction of Arabidopsis miR398 represses two Cu/Zn superoxide dismutases.
-
Sucrose positively regulates miR398, resulting in decreased CSD1 and CSD2 mRNA and protein accumulation.
"Here we show that miR398 is positively regulated by sucrose, resulting in decreased CSD1 and CSD2 mRNA and protein accumulation."
Biotic and abiotic stress down-regulate miR398 expression in Arabidopsis.
-
CSD1 mRNA levels negatively correlate with miR398 during ozone, salinity, and avirulent Pseudomonas syringae stress.
"CSD1, but not CSD2, mRNA levels were negatively correlated with miR398 levels during ozone, salinity and biotic stress, suggesting that CSD2 regulation is not strictly under miR398 control during diverse stresses."
The Arabidopsis DJ-1a protein confers stress protection through cytosolic SOD activation.
-
AtDJ-1a physically interacts with CSD1 (SOD1) and promotes its cytosolic activation in a copper-dependent manner.
"We further identify superoxide dismutase 1 (SOD1) and glutathione peroxidase 2 (GPX2) as interaction partners of both AtDJ-1a and human DJ-1, and show that this interaction results in AtDJ-1a- and DJ-1-mediated cytosolic SOD1 activation in a copper-dependent fashion."
Effect of Cu content on the activity of Cu/ZnSOD1 in the Arabidopsis SUMO E3 ligase siz1 mutant.
-
Excess copper induces shoot CSD1 protein level and enzymatic activity in wild-type Arabidopsis.
"We further examined the expression and enzymatic activity of Cu/ZnSOD1 (CSD1) in shoots of the siz1 mutant under excess Cu. Shoot CSD1 protein level and activity were reduced in siz1 with excess Cu but induced in the wild type."
A proteomic strategy for global analysis of plant protein complexes.
UniProtKB: P24704 (SODC1_ARATH)
-
CSD1 is a cytosolic and nuclear Cu/Zn superoxide dismutase that binds one copper and one zinc ion per subunit.
"SUBCELLULAR LOCATION: Cytoplasm, cytosol {ECO:0000269|PubMed:20406884}. Nucleus {ECO:0000269|PubMed:20406884}."
TarDB experimentally supported Arabidopsis thaliana miRNA-target degradome interactions
-
Degradome PARE-seq validates Category-0 cleavage of CSD1 (AT1G08830.1) by ath-miR398a-3p (p = 0.00494).
"ath-miR398a-3p miR398 AT1G08830.1 AT1G08830 CSD1 0 0.00494 tar 5' AAGGGGUUUCCUGAGAUCACA 3' | |||||||xx|||||||x|||| | miR 3' UUCCCCACUGGACUCUUGUGU 5'"