TAV2_LOCUS3068 (DCL1, A0AAU9RFA2) Curation Notes — Thlaspi arvense

Orthology and Domain Architecture

• Gene symbol / Locus: TAV2_LOCUS3068 (Tarvense_21196, protein accession CAH2039182.1, UniProt A0AAU9RFA2, 1910 AA,Chromosome 1).
• Ortholog: Direct 1:1 ortholog of Arabidopsis thaliana DCL1 (AT1G01040, Q9SP32, Endoribonuclease Dicer-like 1, 1910 AA).
• Conserved Domain Architecture (TAV2_LOCUS3068-uniprot.txt):
• FT:DOMAIN 263..440: Helicase ATP-binding (PROSITE:PS51192, InterPro:IPR014001)
• FT:DOMAIN 658..836: Helicase C-terminal (PROSITE:PS51194, InterPro:IPR001650)
• FT:DOMAIN 847..942: Dicer dsRNA-binding fold (PROSITE:PS51327, InterPro:IPR005034)
• FT:DOMAIN 1189..1321: PAZ domain (PROSITE:PS50821, InterPro:IPR003100)
• FT:DOMAIN 1364..1522 & 1563..1711: Tandem RNase III domains (PROSITE:PS50142, InterPro:IPR000999)
• FT:DOMAIN 1737..1800 & 1832..1907: Tandem C-terminal dsRNA-binding motifs (DRBM, PROSITE:PS50137, InterPro:IPR014720)

Biological Function & Homeostatic miR162 Feedback Loop

• Primary Core Function: Endoribonuclease Dicer-like 1 (DCL1) is the catalytic core of the nuclear plant Microprocessor complex (with HYL1 and SE) that cleaves primary miRNA transcripts (pri-miRNAs) and precursor miRNAs (pre-miRNAs) via its tandem RNase III domains (RNase IIIa and RNase IIIb) to produce mature ~21-nt miRNA/miRNA* duplexes (PMID:38918606(../../../publications/PMID_38918606.md)).
• Pennycress miRNA Biogenesis & miR162 Negative Feedback:
• Nunn et al. 2022 (PMID:34990041(../../../publications/PMID_34990041.md)) identified 72 miRNA-producing loci across the chromosome-level Thlaspi arvense genome (T_arvense_v2), including tar-mir-162a on scaffold 3 (31,739,144–31,739,240 (-), mature 21-nt 3p sequence TCGATAAACCTCTGCATCCAG).
• Cross-reference against the pennycress transcriptome (thlar_mirna_targets.tsv) confirms that TAV2_LOCUS3068 (A0AAU9RFA2) carries the conserved miR162 target site at CDS nucleotides 3073..3094 (expectation score 2.0, aligned across the exon junction encoding the PAZ-linker region), matching the experimentally verified Category-0 degradome cleavage site in Arabidopsis DCL1 (AT1G01040.1, p = 0.00042 in tardb_ath_degradome.tsv).
• Curation Principle (Actor vs. Substrate): TAV2_LOCUS3068 (DCL1) is the catalytic enzyme of GO:0035196 (miRNA processing). The fact that its own mRNA is cleaved by miR162-loaded RISC is homeostatic negative feedback on DCL1 expression; DCL1's annotation to GO:0035196 is valid because the DCL1 protein itself catalyzes pri/pre-miRNA cleavage.

Review of Existing GOA Annotations (14 IEA rows)

1. GO:0004525 (ribonuclease III activity, IEA) — ACCEPT (core molecular function).
2. GO:0005524 (ATP binding, IEA) — ACCEPT (core cofactor/helicase activity of the DExD/H-box helicase domain).
3. GO:0035196 (miRNA processing, IEA) — ACCEPT (core biological process).
4. GO:0005634 (nucleus, IEA) — ACCEPT (core cellular component; plant DCL1 acts in nuclear dicing bodies / nucleoplasm).
5. GO:0000166 (nucleotide binding, IEA) — MODIFY to GO:0005524 (ATP binding).
6. GO:0003723 (RNA binding, IEA) — MODIFY to GO:0003725 (double-stranded RNA binding).
7. GO:0016787 (hydrolase activity, IEA) — MODIFY to GO:0004525 (ribonuclease III activity).
8. GO:0016891 (RNA endonuclease activity producing 5'-phosphomonoesters, hydrolytic mechanism, IEA) — MODIFY to GO:0004525 (ribonuclease III activity).
9. GO:0006396 (RNA processing, IEA) — MODIFY to GO:0035196 (miRNA processing).
10. GO:0009616 (RNAi-mediated antiviral immune response, IEA) — KEEP_AS_NON_CORE (secondary role; DCL4 and DCL2 are the primary antiviral Dicers in Brassicaceae).
11. GO:0030422 (siRNA processing, IEA) — KEEP_AS_NON_CORE (secondary role in endogenous hairpin/nat-siRNA processing).
12. GO:0003677 (DNA binding, IEA, InterPro:IPR006935) — REMOVE (false-positive domain-to-GO projection from IPR006935 Helicase/UvrB_N; DCL1 binds dsRNA, not DNA).
13. GO:0005737 (cytoplasm, IEA, TreeGrafter PANTHER:PTN004466737) — REMOVE (phylogenetic over-propagation from metazoan cytosolic Dicer clades; plant DCL1 is nuclear).
14. GO:0010267 (ta-siRNA processing, IEA, ARBA:ARBA00090672) — REMOVE (false-positive ARBA rule over-propagated across plant DCL paralogs; DCL4 catalyzes ta-siRNA processing from TAS dsRNA precursors, whereas DCL1 only produces the upstream triggering miRNAs).