TAV2_LOCUS7508 (APS1 / ATPS1, A0AAU9RRK7) Curation Notes — Thlaspi arvense

Orthology and Domain Architecture

• Gene symbol / Locus: TAV2_LOCUS7508 (Tarvense_12925, protein accession CAH2046571.1, UniProt A0AAU9RRK7, 680 AA, Chromosome 2).
• Ortholog: Directpenny-cress ortholog of Arabidopsis thaliana APS1 / ATPS1 (AT3G22890, Q39214, ATP sulfurylase 1, chloroplastic) and member of the plastidic ATP sulfurylase clade (APS1/APS3/APS4).
• Conserved Domain Architecture (TAV2_LOCUS7508-uniprot.txt):
• FT:DOMAIN 265..428: ATP-sulfurylase PUA-like domain (Pfam:PF14306, InterPro:IPR025980)
• FT:DOMAIN 438..659: Sulphate adenylyltransferase catalytic domain (Pfam:PF01747, InterPro:IPR024951, InterPro:IPR002650)
• Absence of APS kinase domain: Like all vascular plant ATP sulfurylases (APS1–APS4), TAV2_LOCUS7508 is a monofunctional ATP sulfurylase (EC 2.7.7.4) and completely lacks an adenylylsulfate kinase (PF01583 / IPR002891, EC 2.7.1.25) domain. In plants, APS kinase activity is encoded by a separate family of four genes (APK1–APK4).

Biological Function & miR395 Regulation of Sulfate/Glucosinolate Flux

• Catalytic Activity & Pathway: ATP sulfurylase (EC 2.7.7.4, GO:0004781) catalyzes the first committed step of plastidic sulfate assimilation (GO:0000103), activating inorganic sulfate ($\text{SO}_4^{2-}$) with ATP to produce adenosine 5'-phosphosulfate (APS) and inorganic pyrophosphate ($\text{PP}_i$) inside the chloroplast stroma (PMID:8058839(../../../publications/PMID_8058839.md), PMID:24027241(../../../publications/PMID_24027241.md)).
• Role in Glucosinolate Biosynthesis: In Brassicaceae, APS produced by plastidic ATPS1 (APS1) is phosphorylated by APS kinase to 3'-phosphoadenosine 5'-phosphosulfate (PAPS), the universal sulfonate donor for glucosinolate core sulfation (including pennycress sinigrin/allylglucosinolate) as well as reduced via APR to sulfide for cysteine/methionine synthesis. Disruption of ATPS1 in Arabidopsis reduces the glucosinolate synthesis rate by ~55% (PMID:24027241(../../../publications/PMID_24027241.md)).
• miR395 Target Site in Pennycress:
• Cross-reference of the 72 pennycress miRNA loci (PMID:34990041(../../../publications/PMID_34990041.md)) against the T_arvense_v2 transcriptome (thlar_mirna_targets.tsv) identifies a high-confidence miR395 (tar-mir-395a/b, mature sequence CTGAAGTGTTTGGGGGAACTC) target site in TAV2_LOCUS7508 at CDS positions 973..993 (expectation score 1.5, 2 total mispairings, 0 seed mismatches), orthologous to the PARE-seq Category-0 cleavage site in Arabidopsis APS1 (AT3G22890.1, p = 0.00346 in tardb_ath_degradome.tsv).
• Curation Principle (Actor vs. Substrate): TAV2_LOCUS7508 mRNA is a substrate of miR395-guided RISC cleavage, not an actor in GO:0035195 (miRNA-mediated post-transcriptional gene silencing). Therefore, GO:0035195 must never be annotated to TAV2_LOCUS7508.

Review of Existing GOA Annotations (4 IEA rows)

1. GO:0004781 (sulfate adenylyltransferase (ATP) activity, IEA) — ACCEPT (core molecular function).
2. GO:0000103 (sulfate assimilation, IEA) — ACCEPT (core biological process).
3. GO:0009507 (chloroplast, IEA) — ACCEPT (core cellular component; plastid/chloroplast localization supported by N-terminal chloroplast transit peptide homology and experimental import of orthologous APS1 in PMID:8058839(../../../publications/PMID_8058839.md)).
4. GO:0004020 (adenylylsulfate kinase activity, IEA, TreeGrafter PANTHER:PTN004223551) — REMOVE (classic TreeGrafter domain-fusion false positive inherited from metazoan bifunctional PAPS synthases PAPSS1/PAPSS2 in PTHR11055; plant APS1 and TAV2_LOCUS7508 contain only PUA-like and ATP sulfurylase domains and lack the APS kinase domain).