Gene Ontology annotation through association of InterPro records with GO terms.
Combined automated annotation using Multiple IEA Methods.
An Arabidopsis gene regulatory network for secondary cell wall synthesis.
-
LAC4/IRX12 (At2g38080) is directly regulated within the Arabidopsis xylem secondary cell wall and lignin biosynthesis transcriptional network.
"KOR/IRX2 (At5g49720), LAC4/IRX12 (At2g38080), and REF8 (At2g40890) are described in Supplementary Table 6."
Lignin-based barrier restricts pathogens to the infection site and confers resistance in plants.
-
In plants, laccases oxidatively polymerize monolignols into lignin units in the apoplast rather than degrading lignin.
"After their synthesis, monolignols are transported from the cytosol into the apoplast, where they are oxidatively polymerized to lignin units by the actions of laccases and peroxidases (Boerjan et al , 2003 ; Berthet et al , 2011 ; Lee et al , 2013 )."
Chromosome-level Thlaspi arvense genome provides new tools for translational research and for a newly domesticated cash cover crop of the cooler climates.
-
The chromosome-level Thlaspi arvense genome and small RNA annotation identified 72 miRNA-producing loci, including conserved tar-mir-397.
"We identified 72 miRNA‐producing loci, with 53 that were already known from other species, and 19 appeared to be species‐specific."
UniProtKB entry A0AAU9S9S2 (TAV2_LOCUS14099_THLAR): Laccase
-
TAV2_LOCUS14099 belongs to PANTHER subfamily PTHR11709:SF370 (LACCASE-4) and possesses an N-terminal signal peptide (AA 1-24), three plastocyanin-like cupredoxin domains (AA 33-146, 160-307, and 409-541), and conserved multicopper oxidase copper-binding sites (IPR002355, IPR017761).
"DR PANTHER; PTHR11709:SF370; LACCASE-4; 1."
Pennycress (Thlaspi arvense v2) miRNA-target regulatory network table
-
TAV2_LOCUS14099 (A0AAU9S9S2) is orthologous to Arabidopsis LAC4 (AT2G38080) and contains a conserved miR397 target site at CDS positions 669-689 (expectation score 2.5) involved in regulating secondary cell wall and seed coat lignification.
"miR397 TCATTGAGTGCATCGTTGATG TAV2_LOCUS14099 Tarvense_20158 CAH2058852.1 A0AAU9S9S2 Laccase (EC 1.10.3.2) (Benzenediol:oxygen oxidoreductase) (Diphenol oxidase) (Urishiol oxidase) LAC2/LAC4/LAC17 (AT2G29130/AT2G38080/AT5G60020; Laccases; seed coat/stem lignin biosynthesis & copper homeostasis) 669 689 2.5 3 1 Yes"
TarDB degradome/PARE-seq experimentally supported miRNA-target cleavage sites in Arabidopsis thaliana