Gene Ontology annotation through association of InterPro records with GO terms.
Automaticassignment of GO terms using UniRule.
Electronic Gene Ontology annotations created by ARBA machine learning models.
TreeGrafter-generated GO annotations.
Combined automated annotation using Multiple IEA Methods.
Partially redundant functions of Arabidopsis DICER-like enzymes and a role for DCL4 in producing trans-acting siRNAs.
-
Among the four Arabidopsis Dicer-like proteins, DCL1 produces miRNAs whereas DCL4 is the primary processor of RDR6-dependent trans-acting siRNAs (ta-siRNAs).
"Arabidopsis encodes four DICER-like (DCL) proteins. DCL1 produces miRNAs, DCL2 produces some virus-derived siRNAs, and DCL3 produces endogenous RDR2-dependent siRNAs, but the role of DCL4 is unknown. We show that DCL4 is the primary processor of endogenous RDR6-dependent trans-acting siRNAs (tasiRNAs)."
Dissecting Arabidopsis thaliana DICER function in small RNA processing, gene silencing and DNA methylation patterning.
-
In addition to its major role in processing miRNAs, DCL1 has a secondary role in producing small RNAs from endogenous inverted repeats.
"Sequencing of small RNAs from a dcl2 dcl3 dcl4 triple mutant showed markedly reduced tasiRNA and siRNA production and indicated that DCL1, in addition to its role as the major enzyme for processing miRNAs, has a previously unknown role in the production of small RNAs from endogenous inverted repeats."
Four plant Dicers mediate viral small RNA biogenesis and DNA virus induced silencing.
-
While DCL4 is the primary antiviral Dicer against RNA viruses, DCL1 contributes to viral siRNA biogenesis by generating 21-nt siRNAs from nuclear DNA virus leader hairpins such as the CaMV 35S leader.
"DNA virus-derived small interfering RNAs (siRNAs) of specific size classes (21, 22 and 24 nt) are produced by all four DCLs, including DCL1, known to process microRNA precursors. Specifically, DCL1 generates 21 nt siRNAs from the CaMV leader region."
Identification of nuclear dicing bodies containing proteins for microRNA biogenesis in living Arabidopsis plants.
-
Unlike animal miRNA processing where the second dicing step is cytoplasmic, both steps of plant miRNA processing occur in the nucleus via DCL1, SE, and HYL1 within nuclear dicing bodies (D-bodies) and the nucleoplasm.
"In animal cells, the first step is nuclear and the second step cytoplasmic, whereas in plant cells, both steps occur in the nucleus via the enzyme Dicer-like1 (DCL1) and other proteins including the zinc-finger-domain protein Serrate (SE) and a double-stranded RNA (dsRNA) binding-domain protein, Hyponastic Leaves1 (HYL1)."
-
In addition to miRNA processing, DCL1 participates in processing endogenous inverted repeats and pathogen-induced endogenous siRNAs.
"Apart from miRNAs, DCL1 has also been shown to be involved in the processing of endogenous inverted repeats and endogenous siRNAs induced by bacterial pathogens"
Chromosome-level Thlaspi arvense genome provides new tools for translational research and for a newly domesticated cash cover crop of the cooler climates.
-
Small RNA sequencing and genome annotation of Thlaspi arvense identified 72 miRNA-producing loci (53 conserved and 19 novel), processed by the canonical plant miRNA biogenesis pathway.
"We identified 72 miRNA‐producing loci, with 53 that were already known from other species, and 19 appeared to be species‐specific."
Parallel degradome-seq and DMS-MaPseq substantially revise the miRNA biogenesis atlas in Arabidopsis.
-
In Brassicaceae (Arabidopsis thaliana), DCL1 forms the core nuclear Microprocessor complex with HYL1 and SE to sequentially process pri-miRNAs to pre-miRNAs and mature miRNA/miRNA* duplexes.
"Arabidopsis Microprocessor comprises Dicer-like1 (DCL1) and two core cofactors, zinc-finger protein Serrate (SE) and a dsRNA-binding protein called hyponastic leaves 1 (HYL1)"
-
For base-to-loop (BTL)-processed pri-miRNAs, the tandem RNase IIIb and RNase IIIa domains of DCL1 cleave the 5' and 3' arms of pri-miRNA hairpins respectively in vivo and in vitro, whereas for loop-to-base (LTB)-processed pri-miRNAs the RNase IIIa and IIIb domains cut the 5' and 3' arms respectively.
"We also found that DCL1 RNase domain b first cleaved at the 5′ arm of pri-miRNA in the DCL1E1507Q line, while DCL1 RNase domain a fulfilled the first cleavage at the 3′ arm in the DCL1E1696Q line for the BTL-type pri-miRNAs. By contrast, the DCL1 RNase domains a and b cut the 5′ and 3′ arms, respectively, for the LTB-type pri-miRNAs."
UniProtKB entry A0AAU9RFA2 (TAV2_LOCUS3068_THLAR): Uncharacterized protein
-
TAV2_LOCUS3068 belongs to the PANTHER Dicer family (PTHR14950:SF37) and contains conserved Helicase ATP-binding (263-440), Helicase C-terminal (658-836), Dicer dsRNA-binding fold (847-942), PAZ (1189-1321), tandem RNase III (1364-1522 and 1563-1711), and tandem DRBM (1737-1800 and 1832-1907) domains.
"DR PANTHER; PTHR14950:SF37; ENDORIBONUCLEASE DICER; 1."
Pennycress (Thlaspi arvense v2) miRNA-target regulatory network table
-
TAV2_LOCUS3068 (A0AAU9RFA2) is the 1:1 pennycress ortholog of Arabidopsis DCL1 (AT1G01040) and contains a conserved miR162 binding site at CDS positions 3073-3094 (expectation score 2.0) that mediates autoregulatory negative feedback on DCL1 mRNA.
"miR162 TCGATAAACCTCTGCATCCAG TAV2_LOCUS3068 Tarvense_21196 CAH2039182.1 A0AAU9RFA2 Uncharacterized protein DCL1 (AT1G01040; Endoribonuclease Dicer-like 1; miRNA biogenesis homeostatic feedback) 3073 3094 2.0 1 0 Yes"
TarDB degradome/PARE-seq experimentally supported miRNA-target cleavage sites in Arabidopsis thaliana
-
Degradome PARE-seq in Arabidopsis thaliana confirms Category-0 ath-miR162a-3p cleavage of DCL1 (AT1G01040.1, p = 0.00042).
"ath-miR162a-3p miR162 AT1G01040.1 AT1G01040 DCL1 0 0.00042"