Electronic annotation of UniProtKBSubCell terms to Gene Ontology terms.
TreeGrafter-generated GO annotations.
Combined automated annotation using Multiple IEA Methods.
Cloning of a cDNA encoding ATP sulfurylase from Arabidopsis thaliana by functional expression in Saccharomyces cerevisiae.
-
Arabidopsis APS1 encodes a chloroplastic ATP sulfurylase that catalyzes the formation of adenosine 5'-phosphosulfate (APS) from ATP and inorganic sulfate and is imported into intact chloroplasts.
"ATP sulfurylase, the first enzyme in the sulfate assimilation pathway of plants, catalyzes the formation of adenosine phosphosulfate from ATP and sulfate."
-
APS1 possesses an N-terminal chloroplast transit peptide and enters isolated intact chloroplasts.
"Two lines of evidence indicate that APS1 encodes a chloroplast form of ATP sulfurylase. Its predicted amino-terminal sequence resembles a chloroplast transit peptide; and the APS1 polypeptide, synthesized in vitro, is capable of entering isolated intact chloroplasts."
Natural variation in the ATPS1 isoform of ATP sulfurylase contributes to the control of sulfate levels in Arabidopsis.
-
Plastidic ATP sulfurylase (ATPS1/APS1) activates inorganic sulfate to APS as the first step of sulfate assimilation and controls flux into both primary sulfate reduction and secondary glucosinolate biosynthesis (~55% reduction in glucosinolate synthesis rate in atps1 mutants).
"In sulfate assimilation, sulfate has to be first activated by ATP sulfurylase to adenosine 5′-phosphosulfate ( APS ), which is reduced in two steps, by adenosine 5′-phosphosulfate reductase ( APR ) to sulfite and subsequently by sulfite reductase to sulfide."
-
Loss of ATPS1 reduces glucosinolate biosynthesis rate by approximately 55% in Brassicaceae.
"Disruption of ATPS1 in the Col-0 background diminished the synthesis rate of glucosinolates by approximately 55%"
Chromosome-level Thlaspi arvense genome provides new tools for translational research and for a newly domesticated cash cover crop of the cooler climates.
-
The chromosome-level Thlaspi arvense genome and small RNA atlas identified 72 miRNA loci, including conserved miR395 loci.
"We identified 72 miRNA‐producing loci, with 53 that were already known from other species, and 19 appeared to be species‐specific."
UniProtKB entry A0AAU9RRK7 (TAV2_LOCUS7508_THLAR): sulfate adenylyltransferase
-
TAV2_LOCUS7508 contains only an ATP-sulfurylase PUA-like domain (AA 265-428, PF14306/IPR025980) and a Sulphate adenylyltransferase catalytic domain (AA 438-659, PF01747/IPR024951/IPR002650), and lacks any adenylylsulfate kinase domain.
"DR InterPro; IPR002650; Sulphate_adenylyltransferase."
Pennycress (Thlaspi arvense v2) miRNA-target regulatory network table
-
TAV2_LOCUS7508 (A0AAU9RRK7) is orthologous to Arabidopsis APS1/APS3/APS4 and contains a conserved miR395 target site at CDS positions 973-993 (expectation score 1.5, 2 total mispairings, 0 seed mismatches).
"miR395 CTGAAGTGTTTGGGGGAACTC TAV2_LOCUS7508 Tarvense_12925 CAH2046571.1 A0AAU9RRK7 sulfate adenylyltransferase (EC 2.7.7.4) APS1/APS3/APS4 (AT3G22890/AT4G14680/AT5G43780; ATP sulfurylase; sulfate assimilation for glucosinolate biosynthesis) 973 993 1.5 2 0 Yes"
TarDB degradome/PARE-seq experimentally supported miRNA-target cleavage sites in Arabidopsis thaliana