TAV2_LOCUS14099 (LAC4 / IRX12, A0AAU9S9S2) Curation Notes — Thlaspi arvense

Orthology and Domain Architecture

• Gene symbol / Locus: TAV2_LOCUS14099 (Tarvense_20158, protein accession CAH2058852.1, UniProt A0AAU9S9S2, 558 AA, Chromosome 4).
• Ortholog: Direct 1:1 pennycress ortholog of Arabidopsis thaliana LAC4 / IRX12 (AT2G38080, Q9SR40, Laccase-4 / Irregular xylem 12, 558 AA).
• Conserved Domain Architecture (TAV2_LOCUS14099-uniprot.txt):
• FT:SIGNAL 1..24: N-terminal secretory signal peptide targeting the protein to the apoplast/secondary cell wall.
• FT:DOMAIN 33..146, 160..307, 409..541: Three cupredoxin / plastocyanin-like multicopper oxidase domains (Pfam:PF07732, PF00394, PF07731; InterPro:IPR017761, IPR002355) coordinating four copper ions (Type 1, Type 2, and binuclear Type 3 copper centers).
• DR:PANTHER: PTHR11709:SF370 (LACCASE-4).

Biological Function & miR397 Regulation of Lignification

• Lignin Biosynthesis vs. Lignin Catabolism (InterPro2GO / RuleBase Defect):
• Unreviewed TrEMBL record A0AAU9S9S2 carries an automated RuleBase/InterPro2GO annotation to GO:0046274 (lignin catabolic process) from InterPro:IPR017761 (Laccase) and RuleBase:RU361119 ("Lignin degradation and detoxification of lignin-derived products"), which was authored for wood-rotting basidiomycete fungal laccases.
• In land plants, apoplastic laccases (LAC4/IRX12, LAC17, LAC2, LAC15) do not degrade lignin; instead, they oxidize monolignols (coniferyl and sinapyl alcohols) to phenoxyl radicals that undergo oxidative radical coupling to polymerize/synthesize lignin (GO:0009809, lignin biosynthetic process) in vascular secondary cell walls and seed coats (PMID:25533953(../../../publications/PMID_25533953.md), PMID:31559647(../../../publications/PMID_31559647.md)).
• miR397 Target Site in Pennycress:
• Cross-reference of the 72 pennycress miRNA loci (PMID:34990041(../../../publications/PMID_34990041.md)) against the T_arvense_v2 transcriptome (thlar_mirna_targets.tsv) shows that TAV2_LOCUS14099 (A0AAU9S9S2) contains a conserved miR397 (tar-mir-397, mature sequence TCATTGAGTGCATCGTTGATG) target site at CDS positions 669..689 (expectation score 2.5), matching the experimentally verified Category-0 degradome cleavage site in Arabidopsis LAC4/IRX12 (AT2G38080.1, p = 0.00084 in tardb_ath_degradome.tsv).
• In pennycress domestication, reducing seed coat thickness and klason lignin content (analogous to tt8 transparent testa lines) improves seed meal protein digestibility and oil extraction efficiency.

Review of Existing GOA Annotations (5 IEA rows)

1. GO:0052716 (hydroquinone:oxygen oxidoreductase activity, IEA) — ACCEPT (core laccase catalytic activity, EC 1.10.3.2).
2. GO:0005507 (copper ion binding, IEA) — ACCEPT (core cofactor binding of multicopper oxidase).
3. GO:0048046 (apoplast, IEA) — ACCEPT (core cellular component; secreted into the apoplast/cell wall via signal peptide AA 1..24).
4. GO:0016491 (oxidoreductase activity, IEA) — MODIFY to GO:0052716 (hydroquinone:oxygen oxidoreductase activity).
5. GO:0046274 (lignin catabolic process, IEA, InterPro:IPR017761) — MODIFY to GO:0009809 (lignin biosynthetic process) (corrects the fungal-laccase catabolic mis-mapping to the true plant monolignol-polymerizing biosynthetic process).