Superoxide dismutase [Cu-Zn] 1 (CSD1, AT1G08830) is the major cytosolic and nuclear copper/zinc superoxide dismutase in Arabidopsis thaliana. It functions as a homodimer that binds one catalytic copper ion and one structural zinc ion per subunit to catalyze the disproportionation of superoxide radicals into molecular oxygen and hydrogen peroxide, providing frontline antioxidant defense against oxidative stress triggered by high light, ozone, UV-B radiation, salinity, and pathogen challenge. Its copper-dependent enzymatic activation in the cytosol is facilitated by the copper chaperone for superoxide dismutase (CCS) and the stress-protective protein DJ-1a, while its transcript abundance is post-transcriptionally repressed by miR398-directed mRNA cleavage in response to copper limitation and sucrose levels.
| GO Term | Evidence | Action | Reason |
|---|---|---|---|
| GO:0004784 superoxide dismutase activity | IBA GO_REF:0000033 | ACCEPT | Summary: Core enzymatic activity of CSD1 catalyzing the dismutation of superoxide radicals into hydrogen peroxide and oxygen. Reason: Supported by phylogenetic conservation across eukaryotic Cu/Zn superoxide dismutases (PTN000000113) and direct biochemical characterization in Arabidopsis thaliana (PMID:9765550). Supporting Evidence: uniprot:P24704 Reaction=2 superoxide + 2 H(+) = H2O2 + O2; Xref=Rhea:RHEA:20696, |
| GO:0004784 superoxide dismutase activity | IEA GO_REF:0000120 | ACCEPT | Summary: Core enzymatic activity of CSD1 catalyzing superoxide radical dismutation. Reason: Consistent with the accepted IBA, TAS, and IDA annotations for GO:0004784. Supporting Evidence: uniprot:P24704 Reaction=2 superoxide + 2 H(+) = H2O2 + O2; Xref=Rhea:RHEA:20696, |
| GO:0004784 superoxide dismutase activity | TAS PMID:9765550 Superoxide dismutase in Arabidopsis: an eclectic enzyme fami... | ACCEPT | Summary: Core superoxide dismutase activity of CSD1. Reason: Directly supported by in-gel SOD activity assays and immunoblot analysis in Kliebenstein et al. 1998 (PMID:9765550). Supporting Evidence: PMID:9765550 Using these antisera and nondenaturing-polyacrylamide gel electrophoresis enzyme assays, we identified protein and activity for two CuZnSODs and for FeSOD and MnSOD in Arabidopsis rosette tissue. |
| GO:0004784 superoxide dismutase activity | IDA PMID:9765550 Superoxide dismutase in Arabidopsis: an eclectic enzyme fami... | ACCEPT | Summary: Direct assay evidence for superoxide dismutase activity of CSD1. Reason: Kliebenstein et al. (1998) resolved and assigned the cytosolic Cu/ZnSOD activity band in Arabidopsis extracts to CSD1 using native PAGE activity gels and isoform-specific antisera. Supporting Evidence: PMID:9765550 Using these antisera and nondenaturing-polyacrylamide gel electrophoresis enzyme assays, we identified protein and activity for two CuZnSODs and for FeSOD and MnSOD in Arabidopsis rosette tissue. |
| GO:0019430 removal of superoxide radicals | IBA GO_REF:0000033 | ACCEPT | Summary: Core biological process performed by CSD1 via enzymatic dismutation of superoxide anions. Reason: Directly entailed by CSD1's superoxide dismutase activity and essential for scavenging cytosolic superoxide radicals in Arabidopsis (PMID:9765550; PMID:16861386). Supporting Evidence: PMID:16861386 Superoxide dismutases (SODs) constitute the first line of defense against highly toxic superoxide radicals by rapidly converting superoxide to hydrogen peroxide (H 2 O 2 ) and molecular oxygen |
| GO:0019430 removal of superoxide radicals | IC PMID:9765550 Superoxide dismutase in Arabidopsis: an eclectic enzyme fami... | ACCEPT | Summary: Curator inference from superoxide dismutase activity (GO:0004784) to removal of superoxide radicals. Reason: Consistent with the accepted IBA annotation for GO:0019430 and directly supported by enzymatic dismutation of superoxide radicals (PMID:9765550). Supporting Evidence: PMID:9765550 A number of environmental stresses can lead to enhanced production of superoxide within plant tissues, and plants are believed to rely on the enzyme superoxide dismutase (SOD) to detoxify this reactive oxygen species. |
| GO:0005507 copper ion binding | IBA GO_REF:0000033 | ACCEPT | Summary: CSD1 binds a catalytic copper ion per subunit at His45, His47, His62, and His119. Reason: Conserved catalytic cofactor binding site of Cu/Zn superoxide dismutases (InterPro IPR024134; PTN000000113) and experimentally required for CSD1 activation (PMID:15772282; PMID:20406884). Supporting Evidence: uniprot:P24704 Name=Cu cation; Xref=ChEBI:CHEBI:23378; Evidence={ECO:0000250}; |
| GO:0005507 copper ion binding | IEA GO_REF:0000002 | ACCEPT | Summary: CSD1 binds a catalytic copper ion. Reason: Consistent with the accepted IBA annotation for GO:0005507. Supporting Evidence: uniprot:P24704 Name=Cu cation; Xref=ChEBI:CHEBI:23378; Evidence={ECO:0000250}; |
| GO:0005634 nucleus | IEA GO_REF:0000044 | ACCEPT | Summary: CSD1 localizes to the nucleus in addition to the cytosol. Reason: Consistent with the experimental IDA annotation from PMID:20406884 showing cytosolic and nuclear localization of CSD1. Supporting Evidence: uniprot:P24704 SUBCELLULAR LOCATION: Cytoplasm, cytosol {ECO:0000269|PubMed:20406884}. Nucleus {ECO:0000269|PubMed:20406884}. |
| GO:0005634 nucleus | IDA PMID:20406884 The Arabidopsis DJ-1a protein confers stress protection thro... | ACCEPT | Summary: Direct localization assay showing CSD1 in the nucleus as well as the cytosol. Reason: Xu et al. (2010, PMID:20406884; cached abstract only, full text curated in UniProtKB:P24704) demonstrated cytosolic and nuclear localization of CSD1 and its copper-dependent activator AtDJ-1a. Supporting Evidence: uniprot:P24704 SUBCELLULAR LOCATION: Cytoplasm, cytosol {ECO:0000269|PubMed:20406884}. Nucleus {ECO:0000269|PubMed:20406884}. PMID:20406884 We further identify superoxide dismutase 1 (SOD1) and glutathione peroxidase 2 (GPX2) as interaction partners of both AtDJ-1a and human DJ-1, and show that this interaction results in AtDJ-1a- and DJ-1-mediated cytosolic SOD1 activation in a copper-dependent fashion. |
| GO:0005829 cytosol | IEA GO_REF:0000044 | ACCEPT | Summary: Primary subcellular localization of CSD1 in the cytosol. Reason: Consistent with the experimental IDA, HDA, and TAS annotations for GO:0005829. Supporting Evidence: uniprot:P24704 SUBCELLULAR LOCATION: Cytoplasm, cytosol {ECO:0000269|PubMed:20406884}. |
| GO:0005829 cytosol | HDA PMID:25293756 A proteomic strategy for global analysis of plant protein co... | ACCEPT | Summary: High-throughput proteomic identification of CSD1 in soluble cytosolic protein complexes. Reason: Consistent with CSD1 being the major cytosolic Cu/Zn superoxide dismutase (PMID:9765550; PMID:15772282; PMID:20406884). Supporting Evidence: PMID:15772282 CSD1 encodes a Cu/ZnSOD active in the cytosol, and CSD2 encodes a Cu/ZnSOD active in the chloroplast stroma. |
| GO:0005829 cytosol | IDA PMID:20406884 The Arabidopsis DJ-1a protein confers stress protection thro... | ACCEPT | Summary: Direct experimental localization of CSD1 to the cytosol. Reason: Xu et al. (2010, PMID:20406884) demonstrated cytosolic localization and copper-dependent activation of CSD1 in Arabidopsis. Supporting Evidence: PMID:20406884 We further identify superoxide dismutase 1 (SOD1) and glutathione peroxidase 2 (GPX2) as interaction partners of both AtDJ-1a and human DJ-1, and show that this interaction results in AtDJ-1a- and DJ-1-mediated cytosolic SOD1 activation in a copper-dependent fashion. |
| GO:0005829 cytosol | TAS PMID:12028573 A custom microarray analysis of gene expression during progr... | ACCEPT | Summary: Traceable author statement supporting cytosolic localization of CSD1. Reason: Consistent with the accepted IDA and HDA annotations for GO:0005829. Supporting Evidence: PMID:15772282 CSD1 encodes a Cu/ZnSOD active in the cytosol, and CSD2 encodes a Cu/ZnSOD active in the chloroplast stroma. |
| GO:0006801 superoxide metabolic process | IEA GO_REF:0000002 | MODIFY | Summary: Broad InterPro2GO mapping for Cu/Zn superoxide dismutase domain (IPR001424). Reason: GO:0006801 (superoxide metabolic process) is correct but less specific than GO:0019430 (removal of superoxide radicals), which CSD1 already carries via IBA and IC. Proposed replacements: removal of superoxide radicals Supporting Evidence: PMID:16861386 Superoxide dismutases (SODs) constitute the first line of defense against highly toxic superoxide radicals by rapidly converting superoxide to hydrogen peroxide (H 2 O 2 ) and molecular oxygen |
| GO:0046872 metal ion binding | IEA GO_REF:0000002 | MODIFY | Summary: Broad InterPro2GO mapping for metal ion binding. Reason: GO:0046872 (metal ion binding) is too general; CSD1 specifically binds one catalytic copper ion (GO:0005507, already present) and one structural zinc ion (GO:0008270) per subunit. Proposed replacements: copper ion binding zinc ion binding Supporting Evidence: uniprot:P24704 Note=Binds 1 copper ion per subunit. {ECO:0000250}; uniprot:P24704 Note=Binds 1 zinc ion per subunit. {ECO:0000250}; |
| GO:0071457 cellular response to ozone | IEA GO_REF:0000117 | KEEP AS NON CORE | Summary: CSD1 mRNA and protein are strongly induced by ozone exposure to scavenge ozone-generated superoxide radicals. Reason: Supported by Kliebenstein et al. (1998, PMID:9765550); represents a specific environmental stress response downstream of CSD1's core superoxide dismutase function. Supporting Evidence: PMID:9765550 Previous research showed that mRNA for cytosolic CSD1 is induced in response to ozone fumigation ( Sharma and Davis, 1994 ; Conklin and Last, 1995 ). We confirmed this observation and extended it to show that the CSD1 protein is also rapidly induced in response to ozone (Fig. 10 ). |
| GO:0071457 cellular response to ozone | IEP PMID:9765550 Superoxide dismutase in Arabidopsis: an eclectic enzyme fami... | KEEP AS NON CORE | Summary: CSD1 mRNA and protein accumulate rapidly in response to ozone treatment. Reason: Consistent with the IEA row for GO:0071457; valid stress response context peripheral to the core enzymatic dismutation of superoxide. Supporting Evidence: PMID:9765550 Previous research showed that mRNA for cytosolic CSD1 is induced in response to ozone fumigation ( Sharma and Davis, 1994 ; Conklin and Last, 1995 ). We confirmed this observation and extended it to show that the CSD1 protein is also rapidly induced in response to ozone (Fig. 10 ). |
| GO:0071472 cellular response to salt stress | IEA GO_REF:0000117 | KEEP AS NON CORE | Summary: CSD1 expression responds to salinity stress to mitigate salt-induced ROS accumulation. Reason: Supported by expression profiling under salt stress (PMID:18275461; PMID:19148671); represents a downstream physiological stress context. Supporting Evidence: PMID:18275461 In Col, salt treatments inhibited the expression of FSD1 and strongly stimulated that of CSD1 and MSD. |
| GO:0071472 cellular response to salt stress | IEP PMID:18275461 Long-term effects of mild salt stress on growth, ion accumul... | KEEP AS NON CORE | Summary: Expression of CSD1 is modulated during salt stress in Arabidopsis rosette leaves. Reason: Consistent with the IEA row for GO:0071472; valid non-core stress response annotation. Supporting Evidence: PMID:18275461 In Col, salt treatments inhibited the expression of FSD1 and strongly stimulated that of CSD1 and MSD. |
| GO:0071484 cellular response to light intensity | IEA GO_REF:0000117 | KEEP AS NON CORE | Summary: CSD1 mRNA and protein levels increase in response to higher growth light fluence. Reason: Supported by Kliebenstein et al. (1998, PMID:9765550) and Sunkar et al. (2006, PMID:16861386); represents a specific environmental stimulus context. Supporting Evidence: PMID:9765550 Levels of CSD1 protein significantly increased between the 60 and 125 ΞΌmol m β2 s β1 PAR samples, reflecting the mRNA, but showed no further increase at the higher light levels (Fig. 8 B). |
| GO:0071484 cellular response to light intensity | IEP PMID:9765550 Superoxide dismutase in Arabidopsis: an eclectic enzyme fami... | KEEP AS NON CORE | Summary: CSD1 mRNA and protein increase in response to light intensity changes. Reason: Consistent with the IEA row for GO:0071484; non-core environmental response. Supporting Evidence: PMID:9765550 Levels of CSD1 protein significantly increased between the 60 and 125 ΞΌmol m β2 s β1 PAR samples, reflecting the mRNA, but showed no further increase at the higher light levels (Fig. 8 B). |
| GO:0071493 cellular response to UV-B | IEA GO_REF:0000117 | KEEP AS NON CORE | Summary: CSD1 mRNA and protein are induced in response to UV-B irradiation. Reason: Supported by Kliebenstein et al. (1998, PMID:9765550); non-core environmental stress response. Supporting Evidence: PMID:9765550 Additionally, we showed that the mRNA and protein for CSD1 are induced in response to UV-B illumination and to growth under increasing light fluences (Figs. 9 and 11 ). |
| GO:0071493 cellular response to UV-B | IEP PMID:9765550 Superoxide dismutase in Arabidopsis: an eclectic enzyme fami... | KEEP AS NON CORE | Summary: CSD1 mRNA and protein are induced following UV-B exposure. Reason: Consistent with the IEA row for GO:0071493; non-core environmental response. Supporting Evidence: PMID:9765550 Additionally, we showed that the mRNA and protein for CSD1 are induced in response to UV-B illumination and to growth under increasing light fluences (Figs. 9 and 11 ). |
| GO:0005737 cytoplasm | ISM GO_REF:0000122 | MODIFY | Summary: Sequence-model prediction of cytoplasmic localization. Reason: GO:0005737 (cytoplasm) is less specific than GO:0005829 (cytosol), which is experimentally established for CSD1 (PMID:15772282; PMID:20406884) and already present in existing annotations. Proposed replacements: cytosol Supporting Evidence: PMID:15772282 CSD1 encodes a Cu/ZnSOD active in the cytosol, and CSD2 encodes a Cu/ZnSOD active in the chloroplast stroma. |
| GO:0005737 cytoplasm | NAS PMID:1731963 cDNA and derived amino acid sequence of a cytosolic Cu,Zn su... | MODIFY | Summary: Non-traceable author statement for cytoplasmic localization from initial cDNA cloning paper. Reason: Consistent with the ISM row for GO:0005737; should be refined to the more specific term GO:0005829 (cytosol) already carried by CSD1. Proposed replacements: cytosol Supporting Evidence: PMID:1731963 cDNA and derived amino acid sequence of a cytosolic Cu,Zn superoxide dismutase from Arabidopsis thaliana (L.) Heyhn. |
| GO:0005515 protein binding | IPI PMID:20406884 The Arabidopsis DJ-1a protein confers stress protection thro... | REMOVE | Summary: Physical interaction of CSD1 with AtDJ-1a (UniProtKB:Q9FPF0). Reason: Bare GO:0005515 (protein binding) is uninformative per repository policy; the biological significance of the interaction with AtDJ-1a is copper-dependent activation of CSD1 superoxide dismutase activity (GO:0004784). Supporting Evidence: PMID:20406884 We further identify superoxide dismutase 1 (SOD1) and glutathione peroxidase 2 (GPX2) as interaction partners of both AtDJ-1a and human DJ-1, and show that this interaction results in AtDJ-1a- and DJ-1-mediated cytosolic SOD1 activation in a copper-dependent fashion. |
| GO:0071280 cellular response to copper ion | IEP PMID:21897129 Effect of Cu content on the activity of Cu/ZnSOD1 in the Ara... | KEEP AS NON CORE | Summary: CSD1 transcript abundance and enzymatic activity are regulated by cellular copper availability via the SPL7-miR398 pathway and copper metallochaperones. Reason: Supported by Chen et al. (2011, PMID:21897129) and Abdel-Ghany et al. (2005, PMID:15772282); represents a regulatory response to cofactor availability. Supporting Evidence: PMID:21897129 We further examined the expression and enzymatic activity of Cu/ZnSOD1 (CSD1) in shoots of the siz1 mutant under excess Cu. Shoot CSD1 protein level and activity were reduced in siz1 with excess Cu but induced in the wild type. |
| GO:0034599 cellular response to oxidative stress | IEP PMID:16861386 Posttranscriptional induction of two Cu/Zn superoxide dismut... | ACCEPT | Summary: CSD1 is post-transcriptionally induced during oxidative stress via downregulation of miR398 to detoxify superoxide radicals. Reason: Sunkar et al. (2006, PMID:16861386) demonstrated that CSD1 induction upon oxidative stress is central to cellular oxidative stress tolerance in Arabidopsis. Supporting Evidence: PMID:16861386 Here, we show that miR398 expression is downregulated transcriptionally by oxidative stresses, and this downregulation is important for posttranscriptional CSD1 and CSD2 mRNA accumulation and oxidative stress tolerance. |
| GO:0035195 miRNA-mediated post-transcriptional gene silencing | IEP PMID:16861386 Posttranscriptional induction of two Cu/Zn superoxide dismut... | REMOVE | Summary: Mis-annotation of an mRNA target substrate (CSD1) to the miRNA-mediated post-transcriptional gene silencing machinery. Reason: A gene product is involved_in a biological process only if it performs part of the work of that process. Sunkar et al. (2006, PMID:16861386) and degradome sequencing (TarDB) show that CSD1 mRNA is the cleaved substrate of miR398-guided ARGONAUTE1 RISC; the CSD1 superoxide dismutase protein plays no role in executing miRNA-mediated post-transcriptional gene silencing. Most comparator miRNA targets in Arabidopsis (e.g., SPLs, ARFs, AP2, APS1, LAC4) are not annotated to GO:0035195, and the two other TAIR protein-coding targets carrying GO:0035195 (CSD2 and PXMT1/AT1G66700) reflect the same substrate-vs-actor curation error. Supporting Evidence: PMID:16861386 After 2 d of coexpression with miR398, CSD1 and CSD2 mRNA decreased substantially, which demonstrated that the miR398 can direct the degradation of CSD1 and CSD2 mRNAs in vivo file:projects/THLAR_OILSEED/mirna_targets/tardb_ath_degradome.tsv ath-miR398a-3p miR398 AT1G08830.1 AT1G08830 CSD1 0 0.00494 tar 5' AAGGGGUUUCCUGAGAUCACA 3' | |||||||xx|||||||x|||| | miR 3' UUCCCCACUGGACUCUUGUGU 5' |
| GO:0071329 cellular response to sucrose stimulus | IEP PMID:18392778 Sucrose induction of Arabidopsis miR398 represses two Cu/Zn ... | KEEP AS NON CORE | Summary: Sucrose induces miR398 expression, which post-transcriptionally represses CSD1 mRNA and protein levels. Reason: Supported by Dugas & Bartel (2008, PMID:18392778); represents an upstream metabolic regulation of CSD1 abundance rather than its core enzymatic function. Supporting Evidence: PMID:18392778 Here we show that miR398 is positively regulated by sucrose, resulting in decreased CSD1 and CSD2 mRNA and protein accumulation. |
| GO:0009651 response to salt stress | IEP PMID:19148671 Biotic and abiotic stress down-regulate miR398 expression in... | MODIFY | Summary: CSD1 transcript levels respond to salt stress via miR398 regulation. Reason: GO:0009651 (response to salt stress) is less specific than GO:0071472 (cellular response to salt stress), which CSD1 already carries. Proposed replacements: cellular response to salt stress Supporting Evidence: PMID:19148671 CSD1, but not CSD2, mRNA levels were negatively correlated with miR398 levels during ozone, salinity and biotic stress, suggesting that CSD2 regulation is not strictly under miR398 control during diverse stresses. |
| GO:0010193 response to ozone | IEP PMID:19148671 Biotic and abiotic stress down-regulate miR398 expression in... | MODIFY | Summary: CSD1 expression responds to ozone stress. Reason: GO:0010193 (response to ozone) is less specific than GO:0071457 (cellular response to ozone), which CSD1 already carries. Proposed replacements: cellular response to ozone Supporting Evidence: PMID:19148671 CSD1, but not CSD2, mRNA levels were negatively correlated with miR398 levels during ozone, salinity and biotic stress, suggesting that CSD2 regulation is not strictly under miR398 control during diverse stresses. |
| GO:0042742 defense response to bacterium | IEP PMID:19148671 Biotic and abiotic stress down-regulate miR398 expression in... | KEEP AS NON CORE | Summary: Infiltration with avirulent Pseudomonas syringae downregulates miR398 and induces CSD1 accumulation during the hypersensitive defense response. Reason: Supported by Jagadeeswaran et al. (2009, PMID:19148671); non-core biotic stress context. Supporting Evidence: PMID:19148671 CSD1, but not CSD2, mRNA levels were negatively correlated with miR398 levels during ozone, salinity and biotic stress, suggesting that CSD2 regulation is not strictly under miR398 control during diverse stresses. |
| GO:0010039 response to iron ion | IEP PMID:16861386 Posttranscriptional induction of two Cu/Zn superoxide dismut... | KEEP AS NON CORE | Summary: High iron treatment induces oxidative stress, downregulating miR398 and upregulating CSD1 expression. Reason: Supported by Sunkar et al. (2006, PMID:16861386); non-core heavy metal oxidative stress context. Supporting Evidence: PMID:16861386 Here, we show that miR398 expression is downregulated transcriptionally by oxidative stresses, and this downregulation is important for posttranscriptional CSD1 and CSD2 mRNA accumulation and oxidative stress tolerance. |
| GO:0046688 response to copper ion | IEP PMID:15772282 Two P-type ATPases are required for copper delivery in Arabi... | MODIFY | Summary: CSD1 expression is regulated in response to copper ion availability. Reason: GO:0046688 (response to copper ion) is less specific than GO:0071280 (cellular response to copper ion), which CSD1 already carries. Proposed replacements: cellular response to copper ion Supporting Evidence: PMID:15772282 The cytosolic CSD1 activity increased with Cu feeding in all plant lines ( Figure 9A ), but relative to wild-type plants it was more pronounced in paa1 and paa2 . Immunoblots ( Figure 9B ) and RNA gel blots ( Figure 9C ) indicate that increased CSD1 activity can be ascribed to an increase in gene expression. |
| GO:0006979 response to oxidative stress | IEP PMID:9765550 Superoxide dismutase in Arabidopsis: an eclectic enzyme fami... | MODIFY | Summary: CSD1 expression is induced in response to oxidative stress. Reason: GO:0006979 (response to oxidative stress) is less specific than GO:0034599 (cellular response to oxidative stress), which CSD1 already carries. Proposed replacements: cellular response to oxidative stress Supporting Evidence: PMID:9765550 A number of environmental stresses can lead to enhanced production of superoxide within plant tissues, and plants are believed to rely on the enzyme superoxide dismutase (SOD) to detoxify this reactive oxygen species. |
| GO:0006979 response to oxidative stress | TAS PMID:12028573 A custom microarray analysis of gene expression during progr... | MODIFY | Summary: Traceable author statement for CSD1 involvement in response to oxidative stress. Reason: Consistent with the IEP row for GO:0006979; should be refined to the more specific term GO:0034599 (cellular response to oxidative stress) already carried by CSD1. Proposed replacements: cellular response to oxidative stress Supporting Evidence: PMID:12028573 We show that certain oxidative stress-related genes, including CSD1, CSD3, and GPX, in addition to cysteine proteinases, some transcription factors, and HR-related genes may serve as markers of a core plant cell death programme. |
Loading supporting contentβ¦
Download this section (compressed HTML)Q: How do the copper chaperone CCS and AtDJ-1a partition copper delivery to CSD1 between the cytosolic and nuclear pools during acute oxidative stress?
Experiment: Perform compartment-resolved in vivo copper-loading and SOD activity assays in ccs and dj1a single and double mutants using nuclear vs. cytosolic fractionation under high-light and methyl viologen stress.
Hypothesis: CCS mediates baseline cytosolic and nuclear CSD1 metallation, whereas AtDJ-1a provides rapid stress-inducible activation of pre-existing apo-CSD1.
Loading supporting contentβ¦
Download this section (compressed HTML)Loading supporting contentβ¦
Download this section (compressed HTML)