Secreted multicopper oxidase laccase 4 (EC 1.10.3.2) in field pennycress (Thlaspi arvense), orthologous to Arabidopsis thaliana LAC4/IRX12 (AT2G38080). TAV2_LOCUS14099 is a 558-amino-acid glycoprotein with an N-terminal secretory signal peptide (residues 1-24) and three cupredoxin domains that coordinate four catalytic copper ions in the apoplast. Unlike wood-rotting fungal laccases that degrade lignin, plant LAC4 oxidizes monolignols in the apoplast to drive oxidative radical coupling and lignin polymerization in vascular secondary cell walls and the seed coat. Its transcript contains a conserved miR397 target site at CDS positions 669-689 that post-transcriptionally regulates laccase abundance and cell wall lignification.
| GO Term | Evidence | Action | Reason |
|---|---|---|---|
| GO:0005507 copper ion binding | IEA GO_REF:0000002 | ACCEPT | Reason: TAV2_LOCUS14099 contains three cupredoxin domains and conserved multicopper oxidase copper-binding signatures (IPR002355, PS00079, PS00080) that coordinate four catalytic copper ions. Supporting Evidence: uniprot:A0AAU9S9S2 DR InterPro; IPR002355; Cu_oxidase_Cu_BS. |
| GO:0016491 oxidoreductase activity | IEA GO_REF:0000120 | MODIFY | Reason: Oxidoreductase activity is true but overly broad; refine to the specific laccase catalytic activity GO:0052716 (hydroquinone:oxygen oxidoreductase activity, EC 1.10.3.2) already annotated to this gene. Proposed replacements: hydroquinone:oxygen oxidoreductase activity Supporting Evidence: uniprot:A0AAU9S9S2 DR InterPro; IPR017761; Laccase. |
| GO:0046274 lignin catabolic process | IEA GO_REF:0000002 | MODIFY | Reason: Cross-kingdom InterPro2GO mis-annotation from IPR017761 (Laccase) and UniRule/RuleBase RU361119, which map all laccases to lignin catabolic process (GO:0046274) based on wood-rotting fungal laccases. In land plants, apoplastic laccases such as LAC4/IRX12 oxidize monolignols to polymerize lignin during secondary cell wall synthesis rather than degrading lignin; replace with GO:0009809 (lignin biosynthetic process). Proposed replacements: lignin biosynthetic process Supporting Evidence: PMID:31559647 After their synthesis, monolignols are transported from the cytosol into the apoplast, where they are oxidatively polymerized to lignin units by the actions of laccases and peroxidases (Boerjan et al , 2003 ; Berthet et al , 2011 ; Lee et al , 2013 ). PMID:25533953 KOR/IRX2 (At5g49720), LAC4/IRX12 (At2g38080), and REF8 (At2g40890) are described in Supplementary Table 6. file:projects/THLAR_OILSEED/mirna_targets/thlar_mirna_targets.tsv miR397 TCATTGAGTGCATCGTTGATG TAV2_LOCUS14099 Tarvense_20158 CAH2058852.1 A0AAU9S9S2 Laccase (EC 1.10.3.2) (Benzenediol:oxygen oxidoreductase) (Diphenol oxidase) (Urishiol oxidase) LAC2/LAC4/LAC17 (AT2G29130/AT2G38080/AT5G60020; Laccases; seed coat/stem lignin biosynthesis & copper homeostasis) 669 689 2.5 3 1 Yes |
| GO:0048046 apoplast | IEA GO_REF:0000120 | ACCEPT | Reason: Core cellular component. TAV2_LOCUS14099 possesses a canonical N-terminal signal peptide (AA 1-24) and is secreted into the apoplast and secondary cell wall matrix where monolignol radical coupling takes place. Supporting Evidence: uniprot:A0AAU9S9S2 FT SIGNAL 1..24 |
| GO:0052716 hydroquinone:oxygen oxidoreductase activity | IEA GO_REF:0000120 | ACCEPT | Reason: Core molecular function (EC 1.10.3.2, laccase activity). TAV2_LOCUS14099 belongs to PANTHER subfamily PTHR11709:SF370 (LACCASE-4) and InterPro family IPR017761 (Laccase), catalyzing the O2-dependent oxidation of phenolic monolignol substrates in the plant cell wall. Supporting Evidence: uniprot:A0AAU9S9S2 DR PANTHER; PTHR11709:SF370; LACCASE-4; 1. |
Loading supporting content…
Download this section (compressed HTML)Q: Does seed-coat-specific overexpression of tar-miR397 in pennycress downregulate TAV2_LOCUS14099 and its paralogs (TAV2_LOCUS10945 and TAV2_LOCUS25610) to reduce seed hull lignin content and fiber without causing stem lodging?
Experiment: Perform 5' RLM-RACE on TAV2_LOCUS14099 transcripts in developing pennycress stems and seed coats to map tar-miR397 cleavage at CDS positions 669-689, and quantify acid-insoluble Klason lignin in TAV2_LOCUS14099 CRISPR knockout mutants.
Hypothesis: tar-miR397 directs cleavage of TAV2_LOCUS14099 mRNA at CDS 669-689, and loss of TAV2_LOCUS14099 reduces apoplastic monolignol polymerization in secondary cell walls.
Loading supporting content…
Download this section (compressed HTML)Loading supporting content…
Download this section (compressed HTML)