Endoribonuclease Dicer-like 1 (DCL1) in field pennycress (Thlaspi arvense), orthologous to Arabidopsis thaliana DCL1 (AT1G01040). TAV2_LOCUS3068 is a 1,910-amino-acid nuclear multidomain ribonuclease III enzyme comprising an N-terminal DExD/H-box ATP-binding helicase domain, a Dicer double-stranded RNA-binding fold, a PAZ domain, tandem catalytic RNase IIIa and RNase IIIb domains, and two C-terminal double-stranded RNA-binding motifs (DRBMs). It serves as the catalytic core of the nuclear plant Microprocessor complex, performing sequential ATP-dependent cleavage of primary miRNA transcripts (pri-miRNAs) and precursor miRNAs (pre-miRNAs) to generate mature 21-nucleotide miRNA/miRNA* duplexes. Its own mRNA contains a conserved internal target site for miR162 (CDS positions 3073-3094), establishing an autoregulatory negative feedback loop that maintains miRNA biogenesis homeostasis.
| GO Term | Evidence | Action | Reason |
|---|---|---|---|
| GO:0000166 nucleotide binding | IEA GO_REF:0000104 | MODIFY | Reason: Nucleotide binding is true but overly broad. The N-terminal DExD/H-box helicase domain of DCL1 specifically binds and hydrolyzes ATP (already captured by GO:0005524 ATP binding on this gene), so GO:0000166 should be refined to GO:0005524. Proposed replacements: ATP binding Supporting Evidence: uniprot:A0AAU9RFA2 FT /note="Helicase ATP-binding" |
| GO:0003677 DNA binding | IEA GO_REF:0000002 | REMOVE | Reason: False-positive InterPro2GO projection from IPR006935 (Helicase/UvrB_N), which includes prokaryotic DNA repair helicases (UvrB) alongside RNA helicases. Plant DCL1 binds and excises miRNAs from double-stranded RNA stem-loop structures of primary miRNA transcripts via its helicase, Dicer dsRNA-binding fold, PAZ, RNase III, and DRBM domains and does not bind DNA. Supporting Evidence: uniprot:A0AAU9RFA2 DR InterPro; IPR006935; Helicase/UvrB_N. uniprot:A0AAU9RFA2 FT /note="Dicer dsRNA-binding fold" PMID:17090584 Like their animal counterparts, plant miRNAs are excised from stem-loop structures of primary miRNA gene transcripts by DCL1 in cooperation with its binding partner HYL1 |
| GO:0003723 RNA binding | IEA GO_REF:0000120 | MODIFY | Reason: RNA binding is correct but too general. TAV2_LOCUS3068 contains a Dicer dsRNA-binding fold (AA 847-942, PS51327) and two C-terminal double-stranded RNA-binding motifs (DRBMs, AA 1737-1800 and 1832-1907, PS50137) that specifically recognize double-stranded RNA stems of pri-miRNA and pre-miRNA hairpins; refine to GO:0003725 (double-stranded RNA binding). Proposed replacements: double-stranded RNA binding Supporting Evidence: uniprot:A0AAU9RFA2 FT /note="Dicer dsRNA-binding fold" |
| GO:0004525 ribonuclease III activity | IEA GO_REF:0000120 | ACCEPT | Reason: Core molecular function of DCL1. TAV2_LOCUS3068 contains tandem RNase IIIa and RNase IIIb catalytic domains (AA 1364-1522 and 1563-1711, IPR000999/PS50142) that cleave the 3' and 5' arms of double-stranded pri-miRNA and pre-miRNA hairpins to release mature miRNA/miRNA* duplexes. Supporting Evidence: uniprot:A0AAU9RFA2 DR InterPro; IPR000999; RNase_III_dom. PMID:38918606 We also found that DCL1 RNase domain b first cleaved at the 5′ arm of pri-miRNA in the DCL1E1507Q line, while DCL1 RNase domain a fulfilled the first cleavage at the 3′ arm in the DCL1E1696Q line for the BTL-type pri-miRNAs. By contrast, the DCL1 RNase domains a and b cut the 5′ and 3′ arms, respectively, for the LTB-type pri-miRNAs. |
| GO:0005524 ATP binding | IEA GO_REF:0000120 | ACCEPT | Reason: TAV2_LOCUS3068 possesses a conserved N-terminal DExD/H-box helicase ATP-binding domain (AA 263-440, IPR014001/PS51192), and plant DCL1 requires ATP binding and hydrolysis for processive pri-miRNA remodeling and cleavage. Supporting Evidence: uniprot:A0AAU9RFA2 DR InterPro; IPR014001; Helicase_ATP-bd. |
| GO:0005634 nucleus | IEA GO_REF:0000120 | ACCEPT | Reason: Plant DCL1 localizes to the nucleus (specifically nucleoplasm and nuclear dicing bodies) where it assembles with HYL1 and SE in the plant Microprocessor complex to perform both pri-miRNA and pre-miRNA cleavage steps. Supporting Evidence: PMID:17442570 In animal cells, the first step is nuclear and the second step cytoplasmic, whereas in plant cells, both steps occur in the nucleus via the enzyme Dicer-like1 (DCL1) and other proteins including the zinc-finger-domain protein Serrate (SE) and a double-stranded RNA (dsRNA) binding-domain protein, Hyponastic Leaves1 (HYL1). uniprot:A0AAU9RFA2 DR PANTHER; PTHR14950:SF37; ENDORIBONUCLEASE DICER; 1. |
| GO:0005737 cytoplasm | IEA GO_REF:0000118 | REMOVE | Reason: False-positive TreeGrafter projection from metazoan cytosolic Dicer homologs within PANTHER family PTHR14950. Unlike animal Dicer, which cleaves pre-miRNAs in the cytoplasm, plant DCL1 performs both pri-miRNA and pre-miRNA cleavage steps inside the nucleus. Supporting Evidence: PMID:17442570 In animal cells, the first step is nuclear and the second step cytoplasmic, whereas in plant cells, both steps occur in the nucleus via the enzyme Dicer-like1 (DCL1) and other proteins including the zinc-finger-domain protein Serrate (SE) and a double-stranded RNA (dsRNA) binding-domain protein, Hyponastic Leaves1 (HYL1). |
| GO:0006396 RNA processing | IEA GO_REF:0000002 | MODIFY | Reason: RNA processing is true but too general; the specific biological process performed by DCL1 is miRNA processing (GO:0035196), which is already present on this gene. Proposed replacements: miRNA processing Supporting Evidence: PMID:38918606 Microprocessor sequentially processes pri-miRNAs to precursors of miRNAs (pre-miRNAs) and finally to miRNA/* duplexes |
| GO:0009616 RNAi-mediated antiviral immune response | IEA GO_REF:0000117 | KEEP AS NON CORE | Reason: In Brassicaceae, DCL4 and DCL2 are the primary antiviral Dicers against RNA viruses, while DCL1 contributes a secondary, non-core role by generating 21-nt viral siRNAs from nuclear DNA virus leader hairpins (such as the CaMV 35S leader). Retain as non-core. Supporting Evidence: PMID:17090584 DNA virus-derived small interfering RNAs (siRNAs) of specific size classes (21, 22 and 24 nt) are produced by all four DCLs, including DCL1, known to process microRNA precursors. Specifically, DCL1 generates 21 nt siRNAs from the CaMV leader region. |
| GO:0010267 ta-siRNA processing | IEA GO_REF:0000117 | REMOVE | Reason: Over-propagated ARBA rule across plant Dicer-like paralogs. In Brassicaceae, phased trans-acting siRNA (ta-siRNA) processing from RDR6-synthesized double-stranded TAS precursors is catalyzed by DCL4, not DCL1. DCL1 only generates the upstream triggering miRNAs (such as miR173 and miR390) via its canonical miRNA processing activity (GO:0035196) and does not itself cleave ta-siRNA duplexes. Supporting Evidence: PMID:16040244 Arabidopsis encodes four DICER-like (DCL) proteins. DCL1 produces miRNAs, DCL2 produces some virus-derived siRNAs, and DCL3 produces endogenous RDR2-dependent siRNAs, but the role of DCL4 is unknown. We show that DCL4 is the primary processor of endogenous RDR6-dependent trans-acting siRNAs (tasiRNAs). |
| GO:0016787 hydrolase activity | IEA GO_REF:0000120 | MODIFY | Reason: Hydrolase activity is true but overly broad; refine to the specific catalytic activity GO:0004525 (ribonuclease III activity) already annotated to this gene. Proposed replacements: ribonuclease III activity Supporting Evidence: uniprot:A0AAU9RFA2 DR InterPro; IPR000999; RNase_III_dom. |
| GO:0016891 RNA endonuclease activity producing 5'-phosphomonoesters, hydrolytic mechanism | IEA GO_REF:0000002 | MODIFY | Reason: This parent term is true of RNase III enzymes but less specific than GO:0004525 (ribonuclease III activity), which is already present on this gene. Proposed replacements: ribonuclease III activity Supporting Evidence: uniprot:A0AAU9RFA2 DR InterPro; IPR000999; RNase_III_dom. |
| GO:0030422 siRNA processing | IEA GO_REF:0000118 | KEEP AS NON CORE | Reason: While DCL1's primary function is miRNA processing (GO:0035196), plant DCL1 also contributes a secondary, non-core role in processing small interfering RNAs from endogenous inverted repeats and pathogen-induced endogenous siRNAs. Retain as non-core. Supporting Evidence: PMID:16699516 Sequencing of small RNAs from a dcl2 dcl3 dcl4 triple mutant showed markedly reduced tasiRNA and siRNA production and indicated that DCL1, in addition to its role as the major enzyme for processing miRNAs, has a previously unknown role in the production of small RNAs from endogenous inverted repeats. PMID:17442570 Apart from miRNAs, DCL1 has also been shown to be involved in the processing of endogenous inverted repeats and endogenous siRNAs induced by bacterial pathogens |
| GO:0035196 miRNA processing | IEA GO_REF:0000117 | ACCEPT | Reason: Core biological process of DCL1. TAV2_LOCUS3068 is the pennycress 1:1 ortholog of Arabidopsis DCL1, the catalytic subunit of the nuclear Microprocessor complex responsible for processing the 72 miRNA loci in Thlaspi arvense, and is itself homeostatically regulated by miR162 cleavage at CDS positions 3073-3094. Supporting Evidence: PMID:34990041 We identified 72 miRNA‐producing loci, with 53 that were already known from other species, and 19 appeared to be species‐specific. PMID:38918606 Arabidopsis Microprocessor comprises Dicer-like1 (DCL1) and two core cofactors, zinc-finger protein Serrate (SE) and a dsRNA-binding protein called hyponastic leaves 1 (HYL1) file:projects/THLAR_OILSEED/mirna_targets/thlar_mirna_targets.tsv miR162 TCGATAAACCTCTGCATCCAG TAV2_LOCUS3068 Tarvense_21196 CAH2039182.1 A0AAU9RFA2 Uncharacterized protein DCL1 (AT1G01040; Endoribonuclease Dicer-like 1; miRNA biogenesis homeostatic feedback) 3073 3094 2.0 1 0 Yes |
Loading supporting content…
Download this section (compressed HTML)Q: Does disrupting the miR162 target site in pennycress TAV2_LOCUS3068 (CDS positions 3073-3094) alter global miRNA accumulation—such as miR395, miR397, and miR156/172—and affect seed oil or sinigrin levels?
Experiment: Perform 5' RLM-RACE or PARE-seq (degradome sequencing) in developing pennycress embryos and leaves to directly map the predicted miR162-guided cleavage site between nucleotides 3083 and 3084 of TAV2_LOCUS3068 mRNA.
Hypothesis: tar-miR162a directs Argonaute-mediated endonucleolytic cleavage of TAV2_LOCUS3068 mRNA at the conserved site matching Arabidopsis DCL1, buffering DCL1 transcript abundance.
Loading supporting content…
Download this section (compressed HTML)Loading supporting content…
Download this section (compressed HTML)