ACAT1

Summary: Phylogenetic (IBA) assignment of the acetyl-CoA C-acetyltransferase (acetoacetyl-CoA thiolase, EC 2.3.1.9) activity. This is the well-established core catalytic function of ACAT1/T2 and is concordant with direct biochemical and structural evidence.

Reason: Human structural and kinetic evidence in PMID:17371050 supports this inherited thiolase activity. The PAINT assertion originates at PANTHER:PTN000432378; no target-specific loss or substrate divergence contradicts inheritance. Extant members, including human ACAT1 itself, can legitimately ground the ancestral assertion.

Summary: Electronic assignment (RHEA:21036 / EC 2.3.1.9 mapping) of the core acetyl-CoA C-acetyltransferase activity. Consistent with the IBA and experimental annotations.

Reason: RHEA:21036 and EC:2.3.1.9 match the reversible acetyl-CoA/acetoacetyl-CoA reaction in the cached UniProt record and human kinetic study PMID:17371050. Rat and mouse Acat1 orthologs also appear in this combined IEA source list. Acceptance rests on the matched chemistry and human evidence; the ARBA rule predicates were not independently reconstructed.

Summary: Experimental annotation from characterization of a 3KTD disease allele (A380T / "347Ala to Thr"), where expression analysis showed the mutation destabilizes T2 and impairs the thiolase enzyme. This links the EC 2.3.1.9 thiolase activity directly to ACAT1.

Reason: Core molecular function with experimental (disease-variant expression) support. The curator read the full text; the cached record is abstract-only.

Summary: Experimental annotation from characterization of 3KTD alleles (N158D, T297M, A301P); only T297M retained detectable residual thiolase activity, confirming that the assayed activity is the acetoacetyl-CoA thiolase function of ACAT1.

Reason: Core molecular function supported by mutant-enzyme expression assays.

Summary: The N93S, I312T and A333P disease-variant study reports distinct activity, stability and solubility defects in human T2.

Reason: PMID:9744475 supports the established thiolase function through variant-expression experiments. A333P produced insoluble protein, while other variants retained differing activity and stability. Its structural interpretation used a yeast thiolase model; it did not determine a human mutant structure.

Summary: Direct assay annotation from the crystallographic/kinetic study of human T2, which measured degradation of acetoacetyl-CoA (and 2-methylacetoacetyl-CoA) and the reverse condensation of two acetyl-CoA molecules.

Reason: Core molecular function with direct biochemical and structural evidence (homotetramer, active-site residues, K+ activation).

Summary: IMP annotation from the original cDNA cloning paper, which analyzed T2 in fibroblasts from four 3-ketothiolase-deficiency patients (loss/reduction of the thiolase). Supports the core enzymatic function.

Reason: The human cloning study analyzes patient fibroblast T2 transcript abundance and import, with enzyme-deficiency measurements summarized from the prior patient characterization. These data agree with independent direct human thiolase assays; they should not be presented as a new purified-enzyme kinetic determination.

Summary: IMP annotation from molecular study of the two original 3KTD probands ("the K(+)-activated enzyme, mitochondrial acetoacetyl-coenzyme A thiolase (T2)"), whose mutant alleles impair the thiolase. Supports the core enzymatic function.

Reason: The source identifies a splice defect and a translation-initiation mutation in the two original families with T2 deficiency. These genetic findings support the known thiolase function, without constituting independent substrate-specific kinetic measurements.

Summary: TAS restatement of the core acetyl-CoA C-acetyltransferase activity from the cloning paper.

Reason: Core molecular function; consistent with all other lines of evidence.

Summary: The established thiolase chemistry supports the more specific acetyl-CoA C-acetyltransferase activity.

Reason: The source term is a valid but broad description of acyl transfer. Human structural and kinetic evidence in PMID:17371050 establishes the acetyl-CoA/acetoacetyl-CoA thiolase reaction, supporting GO:0003985 as the more informative MF. The original IDA source itself provides this resolution.

Proposed replacements: acetyl-CoA C-acetyltransferase activity

Summary: The established thiolase chemistry supports the more specific acetyl-CoA C-acetyltransferase activity.

Reason: The source term is a valid but broad description of acyl transfer. Human structural and kinetic evidence in PMID:17371050 establishes the acetyl-CoA/acetoacetyl-CoA thiolase reaction, supporting GO:0003985 as the more informative MF. The original InterPro mapping is preserved; the human primary study supplies independent evidence for refinement rather than a claim that the domain signature alone specifies the substrate.

Proposed replacements: acetyl-CoA C-acetyltransferase activity

Summary: The established thiolase chemistry supports the more specific acetyl-CoA C-acetyltransferase activity.

Reason: The source term is a valid but broad description of acyl transfer. Human structural and kinetic evidence in PMID:17371050 establishes the acetyl-CoA/acetoacetyl-CoA thiolase reaction, supporting GO:0003985 as the more informative MF. The original InterPro mapping is preserved; the human primary study supplies independent evidence for refinement rather than a claim that the domain signature alone specifies the substrate.

Proposed replacements: acetyl-CoA C-acetyltransferase activity

Summary: Direct annotation supported by the crystal structures, which resolve a bound potassium ion near the CoA-binding and catalytic sites; T2 is uniquely activated by K+ (not Na+).

Reason: Genuine, well-evidenced activator/cofactor binding that is a distinctive functional feature of T2, though it is supporting rather than the catalytic core function itself.

Summary: ACAT1 binds the CoA cosubstrate as part of its catalytic mechanism.

Reason: The rat donor chain concerns CoA modification of mitochondrial thiolase; that mechanism is distinct from ordinary reversible ligand binding. Independent human CoA-complex structures in PMID:17371050 and the cached UniProt binding features directly support CoA binding by human ACAT1. This substrate interaction belongs to the core catalytic mechanism.

Summary: The enzyme-binding IEA transfers a rat Acat1 interaction assertion.

Reason: The source is rat P17764/ENSRNOP00000010573. The recovered primary PubMed abstract for PMID:1684101 identifies the partner as mitochondrial glutamate dehydrogenase by amino-acid sequencing and reports reciprocal immunoprecipitation and chemical cross-linking with CoA-modified rat acetyl-CoA acetyltransferase. The 52 kDa partner co-purified only with the CoA-modified forms. Thus the partner and modification-dependent experimental outline are established. The complete primary experiment and conservation of this modification-dependent interaction in human ACAT1 remain unresolved; retain UNDECIDED rather than treating the missing full source as evidence against the interaction.

Summary: ACAT1 self-associates into the functional homotetramer.

Reason: Human structural evidence in PMID:17371050 independently supports self-association. The rat donor record links identical-protein binding to its mitochondrial protein-turnover study (PubMed record 11988101), whose accessible abstract describes oligomeric enzyme. Retain the broad binding assertion as a structural property; do not infer a distinct regulatory binding function.

Summary: The cholesterol paper does not establish cholesterol O-acyltransferase activity for mitochondrial ACAT1.

Reason: Full-text methods and Figure 4 assess lipid droplets, surface-accessible cholesterol, inhibitor responses and viral entry after knockdown. The ER acyl-CoA/cholesterol esterification mechanism is a SOAT-type reaction, distinct from ACAT1 thiolase chemistry; these cellular readouts do not attribute that catalytic activity to P24752. The reported hairpin GCCACTAAGCTTGGTTCCATT does match human ACAT1 NM_000019.4 in Broad GPP, so an ACAT1-dependent phenotype cannot be dismissed as a proven SOAT1-only perturbation. That reagent conflict does not support an enables assertion for cholesterol esterification. Remove the unsupported catalytic assignment without denying a cellular ACAT1 effect or claiming that the actual reagent specificity was independently tested. GO-CAM 6796b94c00004996 repeats the same source interpretation and supplies no independent assay.

Summary: The reported experiments do not establish ER activity or localization of the mitochondrial ACAT1 gene product.

Reason: The full paper states ER localization as part of its cholesterol-acyltransferase model. Figure 4 and the methods measure lipid-droplet staining, surface cholesterol and viral-entry responses; they do not localize the reported ACAT1 knockdown target to the ER or demonstrate its activity there. The exact hairpin matches mitochondrial ACAT1, but an effect of that perturbation on cholesterol handling cannot identify the compartment where the protein acts. Remove this unsupported is_active_in assignment on the basis of the actual assay scope, not because mitochondrial localization excludes all additional pools or because the reagent was proven to target SOAT1. The corresponding GO-CAM uses the same evidence and does not resolve the localization gap.

Summary: PAINT places mitochondrial localization at PANTHER:PTN000432235.

Reason: Mitochondrion is a correct core location at the resolution asserted by this source. Independent human T2 import/fractionation evidence and curated matrix reactions corroborate it. Retaining the organelle term does not claim that this particular assay resolves the matrix.

Summary: The combined IEA uses rat Acat1 and the UniProt mitochondrial compartment vocabulary.

Reason: Mitochondrion is a correct core location at the resolution asserted by this source. Independent human T2 import/fractionation evidence and curated matrix reactions corroborate it. Retaining the organelle term does not claim that this particular assay resolves the matrix.

Summary: The HPA immunofluorescence annotation supports the mitochondrial compartment.

Reason: Mitochondrion is a correct core location at the resolution asserted by this source. Independent human T2 import/fractionation evidence and curated matrix reactions corroborate it. Retaining the organelle term does not claim that this particular assay resolves the matrix.

Summary: PMID:1979337 reports labeled T2 in the particulate fraction while LDH remains cytosolic; the authors interpret this as mitochondrial import.

Reason: Mitochondrion is a correct core location at the resolution asserted by this source. Independent human T2 import/fractionation evidence and curated matrix reactions corroborate it. Retaining the organelle term does not claim that this particular assay resolves the matrix.

Summary: PMID:34800366 provides the curated mitochondrial-proteomics assertion; the individual ACAT1 supplementary entry was not independently re-extracted.

Reason: Mitochondrion is a correct core location at the resolution asserted by this source. Independent human T2 import/fractionation evidence and curated matrix reactions corroborate it. Retaining the organelle term does not claim that this particular assay resolves the matrix.

Summary: The combined ortholog IEA places ACAT1 in the mitochondrial matrix.

Reason: The source list contains rat P17764 and mouse Q8QZT1 with their Ensembl proteins. Rat NCBI/RGD records link matrix IDA evidence to the mitochondrial protein-turnover study (PubMed record 11988101), whose abstract explicitly identifies matrix acetyl-CoA acetyltransferase. Human Reactome thiolase reactions independently support this compartment. A soluble crystal structure alone would not establish matrix localization.

Summary: This Reactome isoleucine-intermediate cleavage reaction places the ACAT1 enzyme in the mitochondrial matrix.

Reason: The curated reaction directly assigns the compartment of the thiolase catalyst and agrees with its established mitochondrial metabolism. Retain the matrix annotation at the source level.

Summary: This Reactome acetyl-CoA condensation in ketogenesis reaction places the ACAT1 enzyme in the mitochondrial matrix.

Reason: The curated reaction directly assigns the compartment of the thiolase catalyst and agrees with its established mitochondrial metabolism. Retain the matrix annotation at the source level.

Summary: This Reactome acetoacetyl-CoA thiolysis in ketolysis reaction places the ACAT1 enzyme in the mitochondrial matrix.

Reason: The curated reaction directly assigns the compartment of the thiolase catalyst and agrees with its established mitochondrial metabolism. Retain the matrix annotation at the source level.

Summary: The Reactome quality-control event includes a mitochondrial-matrix localization assertion for ACAT1.

Reason: Retain the established matrix compartment. The cached event summary discusses a broad protease substrate set and does not itself report an ACAT1-specific degradation assay. This location annotation neither gives ACAT1 protease activity nor establishes participation as the machinery of protein degradation.

Summary: The Reactome quality-control event includes a mitochondrial-matrix localization assertion for ACAT1.

Reason: Retain the established matrix compartment. The cached event summary discusses a broad protease substrate set and does not itself report an ACAT1-specific degradation assay. This location annotation neither gives ACAT1 protease activity nor establishes participation as the machinery of protein degradation.

Summary: The Reactome quality-control event includes a mitochondrial-matrix localization assertion for ACAT1.

Reason: Retain the established matrix compartment. The cached event summary discusses a broad protease substrate set and does not itself report an ACAT1-specific degradation assay. This location annotation neither gives ACAT1 protease activity nor establishes participation as the machinery of protein degradation.

Summary: The Reactome quality-control event includes a mitochondrial-matrix localization assertion for ACAT1.

Reason: Retain the established matrix compartment. The cached event summary discusses a broad protease substrate set and does not itself report an ACAT1-specific degradation assay. This location annotation neither gives ACAT1 protease activity nor establishes participation as the machinery of protein degradation.

Summary: Reactome places the ACAT1 tetramer in the mitochondrial matrix in an IDH2 acetylation event.

Reason: The matrix location is independently supported by the canonical thiolase reactions. The event attributes IDH2 K413 acetylation to Chen et al. 2021; that primary experiment was not independently recovered. PMID:27867011 concerns the PDHA1/PDP1 axis and is not direct evidence for IDH2 acetylation. Retaining this location does not endorse all mechanistic claims of the event.

Summary: Curated high-throughput proteomics assigns ACAT1 to urinary extracellular exosomes.

Reason: Retain the reported localization with deference to the proteomics curator. The individual ACAT1 supplementary entry was not re-extracted, and the accessible paper text does not establish extracellular thiolase catalysis. This is a contextual detection; neither contamination nor biological irrelevance of the detected protein has been demonstrated.

Summary: Curated high-throughput proteomics assigns ACAT1 to urinary extracellular exosomes.

Reason: Retain the reported localization with deference to the proteomics curator. The individual ACAT1 supplementary entry was not re-extracted, and the accessible paper text does not establish extracellular thiolase catalysis. This is a contextual detection; neither contamination nor biological irrelevance of the detected protein has been demonstrated.

Summary: IMP annotation linking ACAT1 to ketone body catabolism (ketolysis), via patient fibroblast analysis in 3-ketothiolase deficiency. T2 catalyzes acetoacetyl-CoA + CoA <=> 2 acetyl-CoA, the key ketolytic thiolase step.

Reason: Core biological process; ketone body metabolism is a principal physiological role of T2.

Summary: Thiolytic cleavage directly produces acetyl-CoA.

Reason: Human T2 catalyzes acetyl-CoA production from acetoacetyl-CoA and from the isoleucine-derived branched substrate in PMID:17371050. ACAT1 performs the chemical step itself, so this product-level process is a valid description of core catalysis, even though ketone-body and isoleucine pathways provide more physiological context.

Summary: The condensation direction of T2 consumes two acetyl-CoA molecules to form acetoacetyl-CoA.

Reason: This directly assayed reaction is part of the established reversible chemistry in PMID:17371050 and the curated ketogenesis reaction. It supports the existing acetyl-CoA catabolic-process assertion without implying all acetyl-CoA-consuming pathways.

Summary: TAS annotation placing ACAT1 in isoleucine catabolism, via its unique ability to cleave the 2-methyl-branched intermediate 2-methylacetoacetyl-CoA - a defining property of T2.

Reason: Core biological process. The 2-methyl-branched substrate specificity is a distinctive feature of T2 and the basis of beta-ketothiolase deficiency as an isoleucine-catabolism disorder.

Summary: IMP annotation from patient-fibroblast analysis in 3-ketothiolase deficiency, an inborn error of isoleucine catabolism. Supports the isoleucine-catabolism role.

Reason: Core biological process supported by the disease phenotype.

Summary: IMP annotation from molecular study of the two original 2-methylacetoacetic-aciduria families with T2 deficiency, consistent with the isoleucine-catabolism role.

Reason: Core biological process; redundant but correctly assigned.

Summary: The thiolase reaction directly interconverts CoA and acyl-CoA species.

Reason: CoA is consumed during thiolytic cleavage and released during acetyl-CoA condensation. Human biochemical evidence in PMID:17371050 supports this broad core metabolic process. It does not establish an independent pathway for constructing the CoA cofactor.

Summary: Release of free CoA during thiolase condensation supports CoA metabolism but overextends the evidence to cofactor biosynthesis.

Reason: Condensation of two acetyl-CoA molecules releases free CoA; thiolysis consumes it. The structural/kinetic source and its author-thesis account establish this interconversion, not construction of the CoA cofactor. The live GO:0015937 definition does not explicitly say de novo, so the judgment rests on reaction context and curation practice rather than an invented definition. As a comparator, MGI experimental annotation snapshots generated 2023-03-10 place the CoA-releasing enzymes human ACOT1, ACOT2 and ACOT8 in acyl-CoA metabolic processes, without this biosynthetic term. These are historical, incomplete comparators rather than a claim of universal current absence. Together with the measured thiolase chemistry, they support treating free-cofactor regeneration here as metabolism, already represented by GO:0015936, rather than an independent CoA biosynthetic role. The original article is abstract-only locally; the author thesis was read separately, not claimed as full original-paper access.

Summary: Cleavage of 2-methylacetoacetyl-CoA directly forms propionyl-CoA and acetyl-CoA.

Reason: ACAT1 catalyzes the product-forming step of isoleucine catabolism, as supported by PMID:17371050 and the explicit Reactome reaction. The existing propionyl-CoA biosynthetic-process assertion therefore describes core chemistry rather than an indirect phenotype.

Summary: The UniPathway beta-oxidation mapping is compatible with ACAT1 cleavage of the short-chain acetoacetyl-CoA intermediate.

Reason: The cached UniProt record explicitly includes a terminal mitochondrial beta-oxidation role. Retain that contribution with short-chain substrate scope; it does not establish general long-chain 3-ketoacyl-CoA thiolysis. The primary human evidence emphasizes ketone-body metabolism and the branched isoleucine intermediate.

Summary: The liver development IEA transfers a rat Acat1 expression-based annotation.

Reason: The rat P17764/ENSRNOP00000010573 donor chain traces through NCBI Gene 25014/RGD to IEP evidence in PMID:5166591. The recovered abstract reports mitochondrial and cytoplasmic aceto-acetyl-CoA thiolase activities across postnatal rat development, with higher mitochondrial activity at all stages. This establishes a developmental enzyme-activity profile, rather than merely an unknown assay, but does not by itself resolve participation in liver development or conservation of that process role in human ACAT1. The full experimental basis of the donor interpretation remains unavailable. Retain UNDECIDED without treating IEP as intrinsically invalid or the abstract's limited scope as evidence against a developmental role.

Summary: The response to hormone IEA transfers a rat Acat1 expression-based annotation.

Reason: Rat P17764/ENSRNOP00000010573 transfers the RGD IEP assertion linked to PMID:6144148. The recovered abstract identifies neonatal L-thyroxine treatment and measurements of ketone-body-utilizing enzyme activities in rat brain. It reports changes in other enzymes but no change in acetoacetyl-CoA thiolase activity. That measurement does not resolve every possible hormone response, and the full experimental basis for the donor annotation remains unavailable. Retain the human transfer as UNDECIDED; neither the IEP code nor one abstract readout alone establishes that the original assertion is false.

Summary: The response to starvation IEA transfers a rat Acat1 expression-based annotation.

Reason: Rat P17764/ENSRNOP00000010573 transfers the RGD IEP assertion linked to PMID:2985752. The recovered abstract describes undernutrition from gestational day 16 through postnatal day 70, with brain mitochondrial enzyme activities including acetoacetyl-CoA thiolase generally lower during suckling and later reaching or exceeding controls. This establishes the nutritional perturbation and measured enzyme response, but does not independently settle the exact starvation-process interpretation or conservation in human ACAT1. The full paper remains unavailable; retain UNDECIDED with these source-specific limits.

Summary: The adipose tissue development IEA transfers a rat Acat1 expression-based annotation.

Reason: Rat P17764/ENSRNOP00000010573 transfers the RGD IEP assertion linked to PubMed record 2866764. The primary abstract reports developmental thiolase activity and acetoacetate oxidation in brown-adipose tissue slices. It establishes metabolic capacity during development, without resolving whether the thiolase contributes to tissue development itself. PMC exposes scanned-page and PDF links, but the page images and full article could not be read in this follow-up. Do not promote an abstract-only absence of a mechanism, or the IEP code alone, into a confident rejection of the original curator interpretation. Keep the human transfer unresolved pending the full source.

Summary: The metanephric proximal convoluted tubule development IEA transfers a rat Acat1 expression-based annotation.

Reason: Rat P17764/ENSRNOP00000010573 transfers the RGD IEP assertion linked to PubMed record 7733320. Its primary abstract measures postnatal enzyme activities in microdissected proximal tubules and thyroid-hormone perturbations. At day 21, thiolase is specifically excepted from the decrease seen for the other mitochondrial enzymes in hypothyroid pups. These observations describe maturation of energy metabolism; they do not by themselves establish that ACAT1 drives tubule formation. The full article remained inaccessible, so the original developmental interpretation and its transfer remain unresolved rather than rejected solely from IEP evidence or missing abstract detail.