ACAT1 encodes mitochondrial acetoacetyl-CoA thiolase (T2; EC 2.3.1.9), a potassium-activated homotetramer acting in the mitochondrial matrix. It catalyzes reversible interconversion of two acetyl-CoA molecules and acetoacetyl-CoA plus CoA, contributing to ketone body synthesis and utilization. It also cleaves the isoleucine-catabolic intermediate 2-methylacetoacetyl-CoA into acetyl-CoA and propionyl-CoA. Biallelic loss of function causes beta-ketothiolase deficiency, with episodic ketoacidosis and accumulation of isoleucine-derived organic acids. This mitochondrial thiolase is distinct from SOAT1, the sterol O-acyltransferase historically also called ACAT1.
| GO Term | Evidence | Action | Reason |
|---|---|---|---|
| GO:0003985 acetyl-CoA C-acetyltransferase activity | IBA GO_REF:0000033 | ACCEPT | Summary: Phylogenetic (IBA) assignment of the acetyl-CoA C-acetyltransferase (acetoacetyl-CoA thiolase, EC 2.3.1.9) activity. This is the well-established core catalytic function of ACAT1/T2 and is concordant with direct biochemical and structural evidence. Reason: Human structural and kinetic evidence in PMID:17371050 supports this inherited thiolase activity. The PAINT assertion originates at PANTHER:PTN000432378; no target-specific loss or substrate divergence contradicts inheritance. Extant members, including human ACAT1 itself, can legitimately ground the ancestral assertion. Propagation Review Root cause: NO FAILURE CORE Sources checked: PANTHER:PTN000432378 SUPPORTS TRANSFER Ancestral PAINT assertion; human biochemical/localization evidence supports inheritance. The full ancestral reconstruction was not repeated. Supporting Evidence: PMID:17371050 Mitochondrial acetoacetyl-coenzyme A (CoA) thiolase (T2) is important in the pathways for the synthesis and degradation of ketone bodies as well as for the degradation of 2-methylacetoacetyl-CoA. |
| GO:0003985 acetyl-CoA C-acetyltransferase activity | IEA GO_REF:0000120 | ACCEPT | Summary: Electronic assignment (RHEA:21036 / EC 2.3.1.9 mapping) of the core acetyl-CoA C-acetyltransferase activity. Consistent with the IBA and experimental annotations. Reason: RHEA:21036 and EC:2.3.1.9 match the reversible acetyl-CoA/acetoacetyl-CoA reaction in the cached UniProt record and human kinetic study PMID:17371050. Rat and mouse Acat1 orthologs also appear in this combined IEA source list. Acceptance rests on the matched chemistry and human evidence; the ARBA rule predicates were not independently reconstructed. Propagation Review Root cause: NO FAILURE CORE Sources checked: ARBA:ARBA00088764 UNRESOLVED Rule identifier is present in GOA; internal predicates were not inspected. Independent reaction and human evidence support the annotation. UniProtKB:P17764 · Acat1 (Rattus norvegicus) UNRESOLVED Rat Acat1 identity is verified. This exact experimental donor chain was not fully reconstructed; human evidence independently supports the annotation. ensembl:ENSRNOP00000010573 · Acat1 (Rattus norvegicus) UNRESOLVED Rat Acat1 identity is verified. This exact experimental donor chain was not fully reconstructed; human evidence independently supports the annotation. UniProtKB:Q8QZT1 · Acat1 (Mus musculus) UNRESOLVED Mouse Acat1 identity is verified. This exact experimental donor chain was not fully reconstructed; human evidence independently supports the annotation. ensembl:ENSMUSP00000034547 · Acat1 (Mus musculus) UNRESOLVED Mouse Acat1 identity is verified. This exact experimental donor chain was not fully reconstructed; human evidence independently supports the annotation. RHEA:21036 SUPPORTS TRANSFER The cached human UniProt catalytic reaction matches acetyl-CoA/acetoacetyl-CoA thiolase chemistry. EC:2.3.1.9 SUPPORTS TRANSFER The cached human UniProt catalytic reaction matches acetyl-CoA/acetoacetyl-CoA thiolase chemistry. |
| GO:0003985 acetyl-CoA C-acetyltransferase activity | EXP PMID:1715688 Evidence for a structural mutation (347Ala to Thr) in a Germ... | ACCEPT | Summary: Experimental annotation from characterization of a 3KTD disease allele (A380T / "347Ala to Thr"), where expression analysis showed the mutation destabilizes T2 and impairs the thiolase enzyme. This links the EC 2.3.1.9 thiolase activity directly to ACAT1. Reason: Core molecular function with experimental (disease-variant expression) support. The curator read the full text; the cached record is abstract-only. Supporting Evidence: PMID:1715688 mitochondrial acetoacetyl-CoA thiolase (T2) biosynthesized in the patient's fibroblasts (GK06) was unstable |
| GO:0003985 acetyl-CoA C-acetyltransferase activity | EXP PMID:7728148 Molecular, biochemical, and clinical characterization of mit... | ACCEPT | Summary: Experimental annotation from characterization of 3KTD alleles (N158D, T297M, A301P); only T297M retained detectable residual thiolase activity, confirming that the assayed activity is the acetoacetyl-CoA thiolase function of ACAT1. Reason: Core molecular function supported by mutant-enzyme expression assays. Supporting Evidence: PMID:7728148 only the mutant T2 polypeptide with T297M appeared to have a detectable residual activity, in spite of its instability |
| GO:0003985 acetyl-CoA C-acetyltransferase activity | EXP PMID:9744475 Characterization of N93S, I312T, and A333P missense mutation... | ACCEPT | Summary: The N93S, I312T and A333P disease-variant study reports distinct activity, stability and solubility defects in human T2. Reason: PMID:9744475 supports the established thiolase function through variant-expression experiments. A333P produced insoluble protein, while other variants retained differing activity and stability. Its structural interpretation used a yeast thiolase model; it did not determine a human mutant structure. Supporting Evidence: PMID:9744475 Mitochondrial acetoacetyl-CoA thiolase (T2) deficiency is an inborn error of ketone body and isoleucine catabolisms. |
| GO:0003985 acetyl-CoA C-acetyltransferase activity | IDA PMID:17371050 Crystallographic and kinetic studies of human mitochondrial ... | ACCEPT | Summary: Direct assay annotation from the crystallographic/kinetic study of human T2, which measured degradation of acetoacetyl-CoA (and 2-methylacetoacetyl-CoA) and the reverse condensation of two acetyl-CoA molecules. Reason: Core molecular function with direct biochemical and structural evidence (homotetramer, active-site residues, K+ activation). Supporting Evidence: PMID:17371050 The kinetic measurements show that T2 can degrade acetoacetyl-CoA and 2-methylacetoacetyl-CoA with similar catalytic efficiencies. |
| GO:0003985 acetyl-CoA C-acetyltransferase activity | IMP PMID:1979337 Molecular cloning and sequence of the complementary DNA enco... | ACCEPT | Summary: IMP annotation from the original cDNA cloning paper, which analyzed T2 in fibroblasts from four 3-ketothiolase-deficiency patients (loss/reduction of the thiolase). Supports the core enzymatic function. Reason: The human cloning study analyzes patient fibroblast T2 transcript abundance and import, with enzyme-deficiency measurements summarized from the prior patient characterization. These data agree with independent direct human thiolase assays; they should not be presented as a new purified-enzyme kinetic determination. Supporting Evidence: PMID:1979337 Complementary DNAs encoding the precursor of human hepatic mitochondrial acetoacetyl-CoA thiolase (T2) (EC 2.3.1.9) were cloned and sequenced. |
| GO:0003985 acetyl-CoA C-acetyltransferase activity | IMP PMID:8103405 Molecular studies of mitochondrial acetoacetyl-coenzyme A th... | ACCEPT | Summary: IMP annotation from molecular study of the two original 3KTD probands ("the K(+)-activated enzyme, mitochondrial acetoacetyl-coenzyme A thiolase (T2)"), whose mutant alleles impair the thiolase. Supports the core enzymatic function. Reason: The source identifies a splice defect and a translation-initiation mutation in the two original families with T2 deficiency. These genetic findings support the known thiolase function, without constituting independent substrate-specific kinetic measurements. Supporting Evidence: PMID:8103405 shown later to have a deficiency of the K(+)-activated enzyme, mitochondrial acetoacetyl-coenzyme A thiolase (T2) |
| GO:0003985 acetyl-CoA C-acetyltransferase activity | TAS PMID:1979337 Molecular cloning and sequence of the complementary DNA enco... | ACCEPT | Summary: TAS restatement of the core acetyl-CoA C-acetyltransferase activity from the cloning paper. Reason: Core molecular function; consistent with all other lines of evidence. |
| GO:0016453 C-acetyltransferase activity | IDA PMID:17371050 Crystallographic and kinetic studies of human mitochondrial ... | MODIFY | Summary: The established thiolase chemistry supports the more specific acetyl-CoA C-acetyltransferase activity. Reason: The source term is a valid but broad description of acyl transfer. Human structural and kinetic evidence in PMID:17371050 establishes the acetyl-CoA/acetoacetyl-CoA thiolase reaction, supporting GO:0003985 as the more informative MF. The original IDA source itself provides this resolution. Proposed replacements: acetyl-CoA C-acetyltransferase activity Supporting Evidence: PMID:17371050 The kinetic measurements show that T2 can degrade acetoacetyl-CoA and 2-methylacetoacetyl-CoA with similar catalytic efficiencies. |
| GO:0016746 acyltransferase activity | IEA GO_REF:0000002 | MODIFY | Summary: The established thiolase chemistry supports the more specific acetyl-CoA C-acetyltransferase activity. Reason: The source term is a valid but broad description of acyl transfer. Human structural and kinetic evidence in PMID:17371050 establishes the acetyl-CoA/acetoacetyl-CoA thiolase reaction, supporting GO:0003985 as the more informative MF. The original InterPro mapping is preserved; the human primary study supplies independent evidence for refinement rather than a claim that the domain signature alone specifies the substrate. Propagation Review Root cause: NO FAILURE CORE Sources checked: InterPro:IPR016039 UNRESOLVED Recorded thiolase signature; current mapping predicates were not independently inspected. The primary human enzyme study, rather than the signature alone, supports substrate-specific refinement. Proposed replacements: acetyl-CoA C-acetyltransferase activity Supporting Evidence: PMID:17371050 The kinetic measurements show that T2 can degrade acetoacetyl-CoA and 2-methylacetoacetyl-CoA with similar catalytic efficiencies. |
| GO:0016747 acyltransferase activity, transferring groups other than amino-acyl groups | IEA GO_REF:0000002 | MODIFY | Summary: The established thiolase chemistry supports the more specific acetyl-CoA C-acetyltransferase activity. Reason: The source term is a valid but broad description of acyl transfer. Human structural and kinetic evidence in PMID:17371050 establishes the acetyl-CoA/acetoacetyl-CoA thiolase reaction, supporting GO:0003985 as the more informative MF. The original InterPro mapping is preserved; the human primary study supplies independent evidence for refinement rather than a claim that the domain signature alone specifies the substrate. Propagation Review Root cause: NO FAILURE CORE Sources checked: InterPro:IPR002155 UNRESOLVED Recorded thiolase signature; current mapping predicates were not independently inspected. The primary human enzyme study, rather than the signature alone, supports substrate-specific refinement. InterPro:IPR020610 UNRESOLVED Recorded thiolase signature; current mapping predicates were not independently inspected. The primary human enzyme study, rather than the signature alone, supports substrate-specific refinement. InterPro:IPR020613 UNRESOLVED Recorded thiolase signature; current mapping predicates were not independently inspected. The primary human enzyme study, rather than the signature alone, supports substrate-specific refinement. InterPro:IPR020615 UNRESOLVED Recorded thiolase signature; current mapping predicates were not independently inspected. The primary human enzyme study, rather than the signature alone, supports substrate-specific refinement. InterPro:IPR020616 UNRESOLVED Recorded thiolase signature; current mapping predicates were not independently inspected. The primary human enzyme study, rather than the signature alone, supports substrate-specific refinement. InterPro:IPR020617 UNRESOLVED Recorded thiolase signature; current mapping predicates were not independently inspected. The primary human enzyme study, rather than the signature alone, supports substrate-specific refinement. Proposed replacements: acetyl-CoA C-acetyltransferase activity Supporting Evidence: PMID:17371050 The kinetic measurements show that T2 can degrade acetoacetyl-CoA and 2-methylacetoacetyl-CoA with similar catalytic efficiencies. |
| GO:0030955 potassium ion binding | IDA PMID:17371050 Crystallographic and kinetic studies of human mitochondrial ... | ACCEPT | Summary: Direct annotation supported by the crystal structures, which resolve a bound potassium ion near the CoA-binding and catalytic sites; T2 is uniquely activated by K+ (not Na+). Reason: Genuine, well-evidenced activator/cofactor binding that is a distinctive functional feature of T2, though it is supporting rather than the catalytic core function itself. Supporting Evidence: PMID:17371050 The potassium ion is bound near the CoA binding site and the catalytic site. |
| GO:0120225 coenzyme A binding | IEA GO_REF:0000107 | ACCEPT | Summary: ACAT1 binds the CoA cosubstrate as part of its catalytic mechanism. Reason: The rat donor chain concerns CoA modification of mitochondrial thiolase; that mechanism is distinct from ordinary reversible ligand binding. Independent human CoA-complex structures in PMID:17371050 and the cached UniProt binding features directly support CoA binding by human ACAT1. This substrate interaction belongs to the core catalytic mechanism. Propagation Review Root cause: NO FAILURE CORE Sources checked: UniProtKB:P17764 · Acat1 (Rattus norvegicus) UNRESOLVED Rat CoA-binding IPI traces to PMID:1672610. Its abstract reports acid-stable, thiol-labile CoA modification confined to partially active A1/A2 forms, not the unmodified fully active enzyme. Human reversible cosubstrate binding is independently established by PMID:17371050; conservation of the specific rat modification mechanism remains unresolved. ensembl:ENSRNOP00000010573 · Acat1 (Rattus norvegicus) UNRESOLVED Rat CoA-binding IPI traces to PMID:1672610. Its abstract reports acid-stable, thiol-labile CoA modification confined to partially active A1/A2 forms, not the unmodified fully active enzyme. Human reversible cosubstrate binding is independently established by PMID:17371050; conservation of the specific rat modification mechanism remains unresolved. Supporting Evidence: PMID:1672610 coenzyme A was found exclusively, e.g., in the modified, partially-active forms A1 und A2 of acetyl-CoA acetyltransferase and not in the unmodified fully-active enzyme. Thus it is evident that this coenzyme A modification is transient. |
| GO:0019899 enzyme binding | IEA GO_REF:0000107 | UNDECIDED | Summary: The enzyme-binding IEA transfers a rat Acat1 interaction assertion. Reason: The source is rat P17764/ENSRNOP00000010573. The recovered primary PubMed abstract for PMID:1684101 identifies the partner as mitochondrial glutamate dehydrogenase by amino-acid sequencing and reports reciprocal immunoprecipitation and chemical cross-linking with CoA-modified rat acetyl-CoA acetyltransferase. The 52 kDa partner co-purified only with the CoA-modified forms. Thus the partner and modification-dependent experimental outline are established. The complete primary experiment and conservation of this modification-dependent interaction in human ACAT1 remain unresolved; retain UNDECIDED rather than treating the missing full source as evidence against the interaction. Propagation Review Root cause: UNRESOLVED Sources checked: UniProtKB:P17764 · Acat1 (Rattus norvegicus) UNRESOLVED Rat IPI enzyme-binding assertion traces to PMID:1684101. Its recovered abstract identifies glutamate dehydrogenase, co-purification only with CoA-modified thiolase, and reciprocal immunoprecipitation/cross-linking. UNRESOLVED concerns the full assay scope and human conservation of this modification-dependent interaction, not donor or partner identity. ensembl:ENSRNOP00000010573 · Acat1 (Rattus norvegicus) UNRESOLVED Rat IPI enzyme-binding assertion traces to PMID:1684101. Its recovered abstract identifies glutamate dehydrogenase, co-purification only with CoA-modified thiolase, and reciprocal immunoprecipitation/cross-linking. UNRESOLVED concerns the full assay scope and human conservation of this modification-dependent interaction, not donor or partner identity. Supporting Evidence: PMID:1684101 The 52 kDa protein was identified as mitochondrial glutamate dehydrogenase (EC 1.4.1.3) by amino acid sequence analysis. |
| GO:0042802 identical protein binding | IEA GO_REF:0000107 | KEEP AS NON CORE | Summary: ACAT1 self-associates into the functional homotetramer. Reason: Human structural evidence in PMID:17371050 independently supports self-association. The rat donor record links identical-protein binding to its mitochondrial protein-turnover study (PubMed record 11988101), whose accessible abstract describes oligomeric enzyme. Retain the broad binding assertion as a structural property; do not infer a distinct regulatory binding function. Propagation Review Root cause: NO FAILURE NON CORE Sources checked: UniProtKB:P17764 · Acat1 (Rattus norvegicus) UNRESOLVED Rat donor identity and the term-specific link to PubMed record 11988101 are established. Its accessible abstract is consistent with oligomeric thiolase, but the full assay and transfer chain were not inspected. The human annotation is retained on independent structural evidence. ensembl:ENSRNOP00000010573 · Acat1 (Rattus norvegicus) UNRESOLVED Rat donor identity and the term-specific link to PubMed record 11988101 are established. Its accessible abstract is consistent with oligomeric thiolase, but the full assay and transfer chain were not inspected. The human annotation is retained on independent structural evidence. |
| GO:0034736 cholesterol O-acyltransferase activity | IDA PMID:32944968 Cholesterol 25-Hydroxylase inhibits SARS-CoV-2 and other cor... | REMOVE | Summary: The cholesterol paper does not establish cholesterol O-acyltransferase activity for mitochondrial ACAT1. Reason: Full-text methods and Figure 4 assess lipid droplets, surface-accessible cholesterol, inhibitor responses and viral entry after knockdown. The ER acyl-CoA/cholesterol esterification mechanism is a SOAT-type reaction, distinct from ACAT1 thiolase chemistry; these cellular readouts do not attribute that catalytic activity to P24752. The reported hairpin GCCACTAAGCTTGGTTCCATT does match human ACAT1 NM_000019.4 in Broad GPP, so an ACAT1-dependent phenotype cannot be dismissed as a proven SOAT1-only perturbation. That reagent conflict does not support an enables assertion for cholesterol esterification. Remove the unsupported catalytic assignment without denying a cellular ACAT1 effect or claiming that the actual reagent specificity was independently tested. GO-CAM 6796b94c00004996 repeats the same source interpretation and supplies no independent assay. Supporting Evidence: PMID:32944968 ACAT1‐shRNA: GCCACTAAGCTTGGTTCCATT PMID:32944968 we used a lipid droplet stain to monitor ACAT activity |
| GO:0005783 endoplasmic reticulum | IDA PMID:32944968 Cholesterol 25-Hydroxylase inhibits SARS-CoV-2 and other cor... | REMOVE | Summary: The reported experiments do not establish ER activity or localization of the mitochondrial ACAT1 gene product. Reason: The full paper states ER localization as part of its cholesterol-acyltransferase model. Figure 4 and the methods measure lipid-droplet staining, surface cholesterol and viral-entry responses; they do not localize the reported ACAT1 knockdown target to the ER or demonstrate its activity there. The exact hairpin matches mitochondrial ACAT1, but an effect of that perturbation on cholesterol handling cannot identify the compartment where the protein acts. Remove this unsupported is_active_in assignment on the basis of the actual assay scope, not because mitochondrial localization excludes all additional pools or because the reagent was proven to target SOAT1. The corresponding GO-CAM uses the same evidence and does not resolve the localization gap. Supporting Evidence: PMID:32944968 ACAT1‐shRNA: GCCACTAAGCTTGGTTCCATT PMID:32944968 The ER‐localized enzyme ACAT uses fatty acyl‐CoA and cholesterol as substrates to produce cholesteryl esters |
| GO:0005739 mitochondrion | IBA GO_REF:0000033 | ACCEPT | Summary: PAINT places mitochondrial localization at PANTHER:PTN000432235. Reason: Mitochondrion is a correct core location at the resolution asserted by this source. Independent human T2 import/fractionation evidence and curated matrix reactions corroborate it. Retaining the organelle term does not claim that this particular assay resolves the matrix. Propagation Review Root cause: NO FAILURE CORE Sources checked: PANTHER:PTN000432235 SUPPORTS TRANSFER Ancestral PAINT assertion; human biochemical/localization evidence supports inheritance. The full ancestral reconstruction was not repeated. |
| GO:0005739 mitochondrion | IEA GO_REF:0000120 | ACCEPT | Summary: The combined IEA uses rat Acat1 and the UniProt mitochondrial compartment vocabulary. Reason: Mitochondrion is a correct core location at the resolution asserted by this source. Independent human T2 import/fractionation evidence and curated matrix reactions corroborate it. Retaining the organelle term does not claim that this particular assay resolves the matrix. Propagation Review Root cause: NO FAILURE CORE Sources checked: UniProtKB:P17764 · Acat1 (Rattus norvegicus) UNRESOLVED Rat Acat1 identity is verified. This exact experimental donor chain was not fully reconstructed; human evidence independently supports the annotation. ensembl:ENSRNOP00000010573 · Acat1 (Rattus norvegicus) UNRESOLVED Rat Acat1 identity is verified. This exact experimental donor chain was not fully reconstructed; human evidence independently supports the annotation. UniProtKB-SubCell:SL-0173 SUPPORTS TRANSFER The cached human UniProt record explicitly names mitochondrion. |
| GO:0005739 mitochondrion | IDA GO_REF:0000052 | ACCEPT | Summary: The HPA immunofluorescence annotation supports the mitochondrial compartment. Reason: Mitochondrion is a correct core location at the resolution asserted by this source. Independent human T2 import/fractionation evidence and curated matrix reactions corroborate it. Retaining the organelle term does not claim that this particular assay resolves the matrix. |
| GO:0005739 mitochondrion | IDA PMID:1979337 Molecular cloning and sequence of the complementary DNA enco... | ACCEPT | Summary: PMID:1979337 reports labeled T2 in the particulate fraction while LDH remains cytosolic; the authors interpret this as mitochondrial import. Reason: Mitochondrion is a correct core location at the resolution asserted by this source. Independent human T2 import/fractionation evidence and curated matrix reactions corroborate it. Retaining the organelle term does not claim that this particular assay resolves the matrix. Supporting Evidence: PMID:1979337 Pulse labeling followed by subcellular fractionation revealed that the T2 proteins in the fibroblasts from these patients are present in the mitochondria. |
| GO:0005739 mitochondrion | HTP PMID:34800366 Quantitative high-confidence human mitochondrial proteome an... | ACCEPT | Summary: PMID:34800366 provides the curated mitochondrial-proteomics assertion; the individual ACAT1 supplementary entry was not independently re-extracted. Reason: Mitochondrion is a correct core location at the resolution asserted by this source. Independent human T2 import/fractionation evidence and curated matrix reactions corroborate it. Retaining the organelle term does not claim that this particular assay resolves the matrix. |
| GO:0005759 mitochondrial matrix | IEA GO_REF:0000120 | ACCEPT | Summary: The combined ortholog IEA places ACAT1 in the mitochondrial matrix. Reason: The source list contains rat P17764 and mouse Q8QZT1 with their Ensembl proteins. Rat NCBI/RGD records link matrix IDA evidence to the mitochondrial protein-turnover study (PubMed record 11988101), whose abstract explicitly identifies matrix acetyl-CoA acetyltransferase. Human Reactome thiolase reactions independently support this compartment. A soluble crystal structure alone would not establish matrix localization. Propagation Review Root cause: NO FAILURE CORE Sources checked: UniProtKB:P17764 · Acat1 (Rattus norvegicus) UNRESOLVED Rat donor identity and the term-specific link to PubMed record 11988101 are established. Its accessible abstract is consistent with matrix thiolase, but the full assay and transfer chain were not inspected. The human annotation is retained on independent Reactome compartment evidence. ensembl:ENSRNOP00000010573 · Acat1 (Rattus norvegicus) UNRESOLVED Rat donor identity and the term-specific link to PubMed record 11988101 are established. Its accessible abstract is consistent with matrix thiolase, but the full assay and transfer chain were not inspected. The human annotation is retained on independent Reactome compartment evidence. UniProtKB:Q8QZT1 · Acat1 (Mus musculus) UNRESOLVED Mouse Acat1 identity is verified. This exact experimental donor chain was not fully reconstructed; human evidence independently supports the annotation. ensembl:ENSMUSP00000034547 · Acat1 (Mus musculus) UNRESOLVED Mouse Acat1 identity is verified. This exact experimental donor chain was not fully reconstructed; human evidence independently supports the annotation. |
| GO:0005759 mitochondrial matrix | TAS Reactome:R-HSA-70844 | ACCEPT | Summary: This Reactome isoleucine-intermediate cleavage reaction places the ACAT1 enzyme in the mitochondrial matrix. Reason: The curated reaction directly assigns the compartment of the thiolase catalyst and agrees with its established mitochondrial metabolism. Retain the matrix annotation at the source level. |
| GO:0005759 mitochondrial matrix | TAS Reactome:R-HSA-73916 | ACCEPT | Summary: This Reactome acetyl-CoA condensation in ketogenesis reaction places the ACAT1 enzyme in the mitochondrial matrix. Reason: The curated reaction directly assigns the compartment of the thiolase catalyst and agrees with its established mitochondrial metabolism. Retain the matrix annotation at the source level. |
| GO:0005759 mitochondrial matrix | TAS Reactome:R-HSA-74181 | ACCEPT | Summary: This Reactome acetoacetyl-CoA thiolysis in ketolysis reaction places the ACAT1 enzyme in the mitochondrial matrix. Reason: The curated reaction directly assigns the compartment of the thiolase catalyst and agrees with its established mitochondrial metabolism. Retain the matrix annotation at the source level. |
| GO:0005759 mitochondrial matrix | TAS Reactome:R-HSA-9838035 | ACCEPT | Summary: The Reactome quality-control event includes a mitochondrial-matrix localization assertion for ACAT1. Reason: Retain the established matrix compartment. The cached event summary discusses a broad protease substrate set and does not itself report an ACAT1-specific degradation assay. This location annotation neither gives ACAT1 protease activity nor establishes participation as the machinery of protein degradation. |
| GO:0005759 mitochondrial matrix | TAS Reactome:R-HSA-9838081 | ACCEPT | Summary: The Reactome quality-control event includes a mitochondrial-matrix localization assertion for ACAT1. Reason: Retain the established matrix compartment. The cached event summary discusses a broad protease substrate set and does not itself report an ACAT1-specific degradation assay. This location annotation neither gives ACAT1 protease activity nor establishes participation as the machinery of protein degradation. |
| GO:0005759 mitochondrial matrix | TAS Reactome:R-HSA-9838093 | ACCEPT | Summary: The Reactome quality-control event includes a mitochondrial-matrix localization assertion for ACAT1. Reason: Retain the established matrix compartment. The cached event summary discusses a broad protease substrate set and does not itself report an ACAT1-specific degradation assay. This location annotation neither gives ACAT1 protease activity nor establishes participation as the machinery of protein degradation. |
| GO:0005759 mitochondrial matrix | TAS Reactome:R-HSA-9838289 | ACCEPT | Summary: The Reactome quality-control event includes a mitochondrial-matrix localization assertion for ACAT1. Reason: Retain the established matrix compartment. The cached event summary discusses a broad protease substrate set and does not itself report an ACAT1-specific degradation assay. This location annotation neither gives ACAT1 protease activity nor establishes participation as the machinery of protein degradation. |
| GO:0005759 mitochondrial matrix | TAS Reactome:R-HSA-9854415 | ACCEPT | Summary: Reactome places the ACAT1 tetramer in the mitochondrial matrix in an IDH2 acetylation event. Reason: The matrix location is independently supported by the canonical thiolase reactions. The event attributes IDH2 K413 acetylation to Chen et al. 2021; that primary experiment was not independently recovered. PMID:27867011 concerns the PDHA1/PDP1 axis and is not direct evidence for IDH2 acetylation. Retaining this location does not endorse all mechanistic claims of the event. |
| GO:0070062 extracellular exosome | HDA PMID:23533145 In-depth proteomic analyses of exosomes isolated from expres... | KEEP AS NON CORE | Summary: Curated high-throughput proteomics assigns ACAT1 to urinary extracellular exosomes. Reason: Retain the reported localization with deference to the proteomics curator. The individual ACAT1 supplementary entry was not re-extracted, and the accessible paper text does not establish extracellular thiolase catalysis. This is a contextual detection; neither contamination nor biological irrelevance of the detected protein has been demonstrated. |
| GO:0070062 extracellular exosome | HDA PMID:19056867 Large-scale proteomics and phosphoproteomics of urinary exos... | KEEP AS NON CORE | Summary: Curated high-throughput proteomics assigns ACAT1 to urinary extracellular exosomes. Reason: Retain the reported localization with deference to the proteomics curator. The individual ACAT1 supplementary entry was not re-extracted, and the accessible paper text does not establish extracellular thiolase catalysis. This is a contextual detection; neither contamination nor biological irrelevance of the detected protein has been demonstrated. |
| GO:0046952 ketone body catabolic process | IMP PMID:1979337 Molecular cloning and sequence of the complementary DNA enco... | ACCEPT | Summary: IMP annotation linking ACAT1 to ketone body catabolism (ketolysis), via patient fibroblast analysis in 3-ketothiolase deficiency. T2 catalyzes acetoacetyl-CoA + CoA <=> 2 acetyl-CoA, the key ketolytic thiolase step. Reason: Core biological process; ketone body metabolism is a principal physiological role of T2. Supporting Evidence: PMID:17371050 important in the pathways for the synthesis and degradation of ketone bodies |
| GO:0006085 acetyl-CoA biosynthetic process | IDA PMID:17371050 Crystallographic and kinetic studies of human mitochondrial ... | ACCEPT | Summary: Thiolytic cleavage directly produces acetyl-CoA. Reason: Human T2 catalyzes acetyl-CoA production from acetoacetyl-CoA and from the isoleucine-derived branched substrate in PMID:17371050. ACAT1 performs the chemical step itself, so this product-level process is a valid description of core catalysis, even though ketone-body and isoleucine pathways provide more physiological context. |
| GO:0046356 acetyl-CoA catabolic process | IDA PMID:17371050 Crystallographic and kinetic studies of human mitochondrial ... | ACCEPT | Summary: The condensation direction of T2 consumes two acetyl-CoA molecules to form acetoacetyl-CoA. Reason: This directly assayed reaction is part of the established reversible chemistry in PMID:17371050 and the curated ketogenesis reaction. It supports the existing acetyl-CoA catabolic-process assertion without implying all acetyl-CoA-consuming pathways. |
| GO:0006550 L-isoleucine catabolic process | TAS PMID:17371050 Crystallographic and kinetic studies of human mitochondrial ... | ACCEPT | Summary: TAS annotation placing ACAT1 in isoleucine catabolism, via its unique ability to cleave the 2-methyl-branched intermediate 2-methylacetoacetyl-CoA - a defining property of T2. Reason: Core biological process. The 2-methyl-branched substrate specificity is a distinctive feature of T2 and the basis of beta-ketothiolase deficiency as an isoleucine-catabolism disorder. Supporting Evidence: PMID:17371050 A unique property of T2 is its ability to use 2-methyl-branched acetoacetyl-CoA as a substrate |
| GO:0006550 L-isoleucine catabolic process | IMP PMID:1979337 Molecular cloning and sequence of the complementary DNA enco... | ACCEPT | Summary: IMP annotation from patient-fibroblast analysis in 3-ketothiolase deficiency, an inborn error of isoleucine catabolism. Supports the isoleucine-catabolism role. Reason: Core biological process supported by the disease phenotype. |
| GO:0006550 L-isoleucine catabolic process | IMP PMID:8103405 Molecular studies of mitochondrial acetoacetyl-coenzyme A th... | ACCEPT | Summary: IMP annotation from molecular study of the two original 2-methylacetoacetic-aciduria families with T2 deficiency, consistent with the isoleucine-catabolism role. Reason: Core biological process; redundant but correctly assigned. Supporting Evidence: PMID:8103405 first reported with 2-methylacetoacetic aciduria, and shown later to have a deficiency of the K(+)-activated enzyme, mitochondrial acetoacetyl-coenzyme A thiolase (T2) |
| GO:0015936 coenzyme A metabolic process | IDA PMID:17371050 Crystallographic and kinetic studies of human mitochondrial ... | ACCEPT | Summary: The thiolase reaction directly interconverts CoA and acyl-CoA species. Reason: CoA is consumed during thiolytic cleavage and released during acetyl-CoA condensation. Human biochemical evidence in PMID:17371050 supports this broad core metabolic process. It does not establish an independent pathway for constructing the CoA cofactor. |
| GO:0015937 coenzyme A biosynthetic process | IDA PMID:17371050 Crystallographic and kinetic studies of human mitochondrial ... | MARK AS OVER ANNOTATED | Summary: Release of free CoA during thiolase condensation supports CoA metabolism but overextends the evidence to cofactor biosynthesis. Reason: Condensation of two acetyl-CoA molecules releases free CoA; thiolysis consumes it. The structural/kinetic source and its author-thesis account establish this interconversion, not construction of the CoA cofactor. The live GO:0015937 definition does not explicitly say de novo, so the judgment rests on reaction context and curation practice rather than an invented definition. As a comparator, MGI experimental annotation snapshots generated 2023-03-10 place the CoA-releasing enzymes human ACOT1, ACOT2 and ACOT8 in acyl-CoA metabolic processes, without this biosynthetic term. These are historical, incomplete comparators rather than a claim of universal current absence. Together with the measured thiolase chemistry, they support treating free-cofactor regeneration here as metabolism, already represented by GO:0015936, rather than an independent CoA biosynthetic role. The original article is abstract-only locally; the author thesis was read separately, not claimed as full original-paper access. |
| GO:1902860 propionyl-CoA biosynthetic process | IDA PMID:17371050 Crystallographic and kinetic studies of human mitochondrial ... | ACCEPT | Summary: Cleavage of 2-methylacetoacetyl-CoA directly forms propionyl-CoA and acetyl-CoA. Reason: ACAT1 catalyzes the product-forming step of isoleucine catabolism, as supported by PMID:17371050 and the explicit Reactome reaction. The existing propionyl-CoA biosynthetic-process assertion therefore describes core chemistry rather than an indirect phenotype. |
| GO:0006635 fatty acid beta-oxidation | IEA GO_REF:0000041 | KEEP AS NON CORE | Summary: The UniPathway beta-oxidation mapping is compatible with ACAT1 cleavage of the short-chain acetoacetyl-CoA intermediate. Reason: The cached UniProt record explicitly includes a terminal mitochondrial beta-oxidation role. Retain that contribution with short-chain substrate scope; it does not establish general long-chain 3-ketoacyl-CoA thiolysis. The primary human evidence emphasizes ketone-body metabolism and the branched isoleucine intermediate. Propagation Review Root cause: NO FAILURE NON CORE Sources checked: UniPathway:UPA00659 SUPPORTS TRANSFER The cached UniProt pathway statement supports a terminal beta-oxidation contribution, with short-chain substrate scope. |
| GO:0001889 liver development | IEA GO_REF:0000107 | UNDECIDED | Summary: The liver development IEA transfers a rat Acat1 expression-based annotation. Reason: The rat P17764/ENSRNOP00000010573 donor chain traces through NCBI Gene 25014/RGD to IEP evidence in PMID:5166591. The recovered abstract reports mitochondrial and cytoplasmic aceto-acetyl-CoA thiolase activities across postnatal rat development, with higher mitochondrial activity at all stages. This establishes a developmental enzyme-activity profile, rather than merely an unknown assay, but does not by itself resolve participation in liver development or conservation of that process role in human ACAT1. The full experimental basis of the donor interpretation remains unavailable. Retain UNDECIDED without treating IEP as intrinsically invalid or the abstract's limited scope as evidence against a developmental role. Propagation Review Root cause: UNRESOLVED Sources checked: UniProtKB:P17764 · Acat1 (Rattus norvegicus) UNRESOLVED Rat Acat1 identity and the term-specific IEP chain to PMID:5166591 are established. Its recovered abstract measures mitochondrial and cytoplasmic thiolase activities across postnatal development, with higher mitochondrial activity throughout. Full-source developmental-process interpretation and transfer to human ACAT1 remain unresolved. ensembl:ENSRNOP00000010573 · Acat1 (Rattus norvegicus) UNRESOLVED Rat Acat1 identity and the term-specific IEP chain to PMID:5166591 are established. Its recovered abstract measures mitochondrial and cytoplasmic thiolase activities across postnatal development, with higher mitochondrial activity throughout. Full-source developmental-process interpretation and transfer to human ACAT1 remain unresolved. Supporting Evidence: PMID:5166591 Both mitochondrial and cytoplasmic aceto-acetyl-CoA thiolase activities were detected, with the mitochondrial enzyme having considerably higher activities at all stages of development. |
| GO:0009725 response to hormone | IEA GO_REF:0000107 | UNDECIDED | Summary: The response to hormone IEA transfers a rat Acat1 expression-based annotation. Reason: Rat P17764/ENSRNOP00000010573 transfers the RGD IEP assertion linked to PMID:6144148. The recovered abstract identifies neonatal L-thyroxine treatment and measurements of ketone-body-utilizing enzyme activities in rat brain. It reports changes in other enzymes but no change in acetoacetyl-CoA thiolase activity. That measurement does not resolve every possible hormone response, and the full experimental basis for the donor annotation remains unavailable. Retain the human transfer as UNDECIDED; neither the IEP code nor one abstract readout alone establishes that the original assertion is false. Propagation Review Root cause: UNRESOLVED Sources checked: UniProtKB:P17764 · Acat1 (Rattus norvegicus) UNRESOLVED The rat IEP donor chain traces to PMID:6144148. Its recovered abstract reports no change in brain mitochondrial thiolase activity after neonatal L-thyroxine treatment, despite changes in two other ketone-body enzymes. This specific null readout is established; the complete basis for the donor process assertion and human transfer remain unresolved. ensembl:ENSRNOP00000010573 · Acat1 (Rattus norvegicus) UNRESOLVED The rat IEP donor chain traces to PMID:6144148. Its recovered abstract reports no change in brain mitochondrial thiolase activity after neonatal L-thyroxine treatment, despite changes in two other ketone-body enzymes. This specific null readout is established; the complete basis for the donor process assertion and human transfer remain unresolved. Supporting Evidence: PMID:6144148 We found an activation of 3-hydroxybutyrate dehydrogenase until 11th day and 3-oxoacid CoA-transferase until 14th day, but no change in acetoacetyl CoA-thiolase was observed. |
| GO:0042594 response to starvation | IEA GO_REF:0000107 | UNDECIDED | Summary: The response to starvation IEA transfers a rat Acat1 expression-based annotation. Reason: Rat P17764/ENSRNOP00000010573 transfers the RGD IEP assertion linked to PMID:2985752. The recovered abstract describes undernutrition from gestational day 16 through postnatal day 70, with brain mitochondrial enzyme activities including acetoacetyl-CoA thiolase generally lower during suckling and later reaching or exceeding controls. This establishes the nutritional perturbation and measured enzyme response, but does not independently settle the exact starvation-process interpretation or conservation in human ACAT1. The full paper remains unavailable; retain UNDECIDED with these source-specific limits. Propagation Review Root cause: UNRESOLVED Sources checked: UniProtKB:P17764 · Acat1 (Rattus norvegicus) UNRESOLVED Rat identity verified by NCBI/RGD and Reactome cross-references. Term-specific IEP evidence links to PubMed record 2985752; full interpretation and human transfer remain unresolved. ensembl:ENSRNOP00000010573 · Acat1 (Rattus norvegicus) UNRESOLVED Rat identity verified by NCBI/RGD and Reactome cross-references. Term-specific IEP evidence links to PubMed record 2985752; full interpretation and human transfer remain unresolved. Supporting Evidence: PMID:2985752 activities in undernourished rats reached or surpassed the control values. |
| GO:0060612 adipose tissue development | IEA GO_REF:0000107 | UNDECIDED | Summary: The adipose tissue development IEA transfers a rat Acat1 expression-based annotation. Reason: Rat P17764/ENSRNOP00000010573 transfers the RGD IEP assertion linked to PubMed record 2866764. The primary abstract reports developmental thiolase activity and acetoacetate oxidation in brown-adipose tissue slices. It establishes metabolic capacity during development, without resolving whether the thiolase contributes to tissue development itself. PMC exposes scanned-page and PDF links, but the page images and full article could not be read in this follow-up. Do not promote an abstract-only absence of a mechanism, or the IEP code alone, into a confident rejection of the original curator interpretation. Keep the human transfer unresolved pending the full source. Propagation Review Root cause: UNRESOLVED Sources checked: UniProtKB:P17764 · Acat1 (Rattus norvegicus) UNRESOLVED Rat identity verified by NCBI/RGD and Reactome cross-references. Term-specific IEP evidence links to PubMed record 2866764; full interpretation and human transfer remain unresolved. ensembl:ENSRNOP00000010573 · Acat1 (Rattus norvegicus) UNRESOLVED Rat identity verified by NCBI/RGD and Reactome cross-references. Term-specific IEP evidence links to PubMed record 2866764; full interpretation and human transfer remain unresolved. |
| GO:0072229 metanephric proximal convoluted tubule development | IEA GO_REF:0000107 | UNDECIDED | Summary: The metanephric proximal convoluted tubule development IEA transfers a rat Acat1 expression-based annotation. Reason: Rat P17764/ENSRNOP00000010573 transfers the RGD IEP assertion linked to PubMed record 7733320. Its primary abstract measures postnatal enzyme activities in microdissected proximal tubules and thyroid-hormone perturbations. At day 21, thiolase is specifically excepted from the decrease seen for the other mitochondrial enzymes in hypothyroid pups. These observations describe maturation of energy metabolism; they do not by themselves establish that ACAT1 drives tubule formation. The full article remained inaccessible, so the original developmental interpretation and its transfer remain unresolved rather than rejected solely from IEP evidence or missing abstract detail. Propagation Review Root cause: UNRESOLVED Sources checked: UniProtKB:P17764 · Acat1 (Rattus norvegicus) UNRESOLVED Rat identity verified by NCBI/RGD and Reactome cross-references. Term-specific IEP evidence links to PubMed record 7733320; full interpretation and human transfer remain unresolved. ensembl:ENSRNOP00000010573 · Acat1 (Rattus norvegicus) UNRESOLVED Rat identity verified by NCBI/RGD and Reactome cross-references. Term-specific IEP evidence links to PubMed record 7733320; full interpretation and human transfer remain unresolved. |
Loading supporting content…
Download this section (compressed HTML)Q: Can the exact ACAT1 reagent, measured knockdown specificity and cellular mechanism in PMID:32944968 be reconciled, and can gene-specific catalytic or localization assays support any future cholesterol-related assertion for P24752?
Q: Does the direct biochemical evidence underlying the earlier PDHA1/PDP1 work and the 2021 IDH2 study justify GO:0061733 protein-lysine-acetyltransferase activity for ACAT1, with controls separating enzymatic lysine acetylation from thiolase chemistry and nonenzymatic acetylation?
Q: Should the original GO:0015937 assertion be reviewed as cofactor regeneration during acyl-CoA metabolism, consistent with the already present GO:0015936, rather than CoA biosynthesis?
Q: After recovering the rat source papers, which expression-based developmental or hormone/starvation annotations establish a transferable process role for human ACAT1?
Experiment: Compare sequence-verified ACAT1 and SOAT1 perturbations, rescued with resistant cognate constructs, while measuring cholesterol esterification, accessible membrane cholesterol and subcellular protein localization.
Hypothesis: Separate perturbations will distinguish indirect effects of mitochondrial thiolase loss from sterol O-acyltransferase catalysis and identify which mechanism explains the reported viral-entry phenotype.
Experiment: Use purified ACAT1 and defined protein substrates to quantify site-specific lysine acetylation with isotope-labeled acetyl-CoA, catalytic variants and matched nonenzymatic controls, alongside an independent thiolase assay.
Hypothesis: A separable protein-lysine transfer activity would generate an ACAT1-dependent acetylated protein product beyond the rate of spontaneous acetylation.
Loading supporting content…
Download this section (compressed HTML)Loading supporting content…
Download this section (compressed HTML)