UFC1 (Ubiquitin-fold modifier-conjugating enzyme 1) is the E2-like conjugating enzyme of the UFM1 (ufmylation) cascade, a ubiquitin-like protein-conjugation system that proceeds through E1 (UBA5), E2 (UFC1) and E3 (UFL1/DDRGK1/CDK5RAP3) enzymes. UFC1 accepts the activated ubiquitin-fold modifier UFM1 from the E1 enzyme UBA5 and forms a thioester-linked intermediate at its catalytic cysteine (Cys-116), then, in concert with the UFL1-DDRGK1 E3 ligase, transfers UFM1 onto substrate lysines. The principal physiological substrate is the 60S ribosomal protein RPL26/uL24 on endoplasmic-reticulum-bound ribosomes, where ufmylation promotes recycling of post-termination or stalled 60S subunits from SEC61 translocons and supports ribosome-associated quality control. UFMylation more broadly participates in the response to ER stress, reticulophagy (ER-phagy), DNA-damage signaling and innate-immune/interferon signaling. UFC1 is a small (167 aa) cytosolic protein structurally related to ubiquitin-conjugating (E2) enzymes; biallelic loss-of-function variants cause a neurodevelopmental disorder with spasticity and poor growth, underscoring an essential role of ufmylation in brain development.
| GO Term | Evidence | Action | Reason |
|---|---|---|---|
| GO:0005737 cytoplasm | IBA GO_REF:0000033 | ACCEPT | Summary: UFC1 is a small soluble protein that acts in the cytoplasm/cytosol, where it receives UFM1 from UBA5 and works with the ER-membrane-anchored UFL1/DDRGK1 E3 to ufmylate ER-bound ribosomes. Reason: Cytoplasmic site of action is consistent with the biochemistry of the cascade; UFC1 is a cytosolic E2 that delivers UFM1 to the membrane-tethered E3 complex. Supporting Evidence: PMID:38383789 we aimed to trap UREL in a state in which it is positioned to transfer UFM1 from the E2 (UFC1) onto RPL26 PMID:38383789 ER-associated 60S ribosomal subunits are preferentially UFMylated in cells |
| GO:0071568 UFM1 transferase activity | IBA GO_REF:0000033 | ACCEPT | Summary: UFM1 transferase activity is a near-synonymous parent of the specific E2 UFM1-conjugating activity of UFC1; it captures the same core molecular function (transfer of UFM1). Reason: UFC1 catalyzes transfer of UFM1 from a thioester intermediate to substrate; this MF term correctly describes that activity, though GO:0061657 (UFM1 conjugating enzyme activity) is the most precise E2-step term. Supporting Evidence: file:human/UFC1/UFC1-uniprot.txt E2-like enzyme which specifically catalyzes the second step in ufmylation |
| GO:0034976 response to endoplasmic reticulum stress | IBA GO_REF:0000033 | KEEP AS NON CORE | Summary: Ufmylation, in which UFC1 is the E2, is induced by and functions in the response to ER stress, linking the modification of ER-bound ribosomes to ER homeostasis. Reason: This is a downstream biological process that UFC1 participates in via its catalytic role; it is a valid pathway context but non-core relative to the E2 conjugating activity. Supporting Evidence: file:human/UFC1/UFC1-uniprot.txt Ufmylation is involved in various processes, such as ribosome recycling, response to DNA damage, interferon response or reticulophagy |
| GO:0061709 reticulophagy | IBA GO_REF:0000033 | KEEP AS NON CORE | Summary: UFC1, as the cascade E2, contributes to reticulophagy (ER-phagy) driven by ER-resident ufmylation. Reason: Reticulophagy is a downstream process of ER ufmylation; a valid but non-core process annotation for the E2 enzyme. Supporting Evidence: file:human/UFC1/UFC1-uniprot.txt Ufmylation is involved in various processes, such as ribosome recycling, response to DNA damage, interferon response or reticulophagy |
| GO:0061657 UFM1 conjugating enzyme activity | IEA GO_REF:0000120 | ACCEPT | Summary: This is the precise E2 molecular function of UFC1 - it forms a thioester intermediate with UFM1 and conjugates it to substrate. Multiple direct experimental annotations corroborate this electronic one. Reason: UFM1 conjugating enzyme (E2) activity is the core molecular function of UFC1, supported by founding biochemistry and structures. Supporting Evidence: file:human/UFC1/UFC1-uniprot.txt Accepts the ubiquitin-like modifier UFM1 from the E1 enzyme UBA5 and forms an intermediate with UFM1 via a thioester linkage |
| GO:0071569 protein ufmylation | IEA GO_REF:0000120 | ACCEPT | Summary: Protein ufmylation is the biological process that the UFC1 E2 step belongs to. Reason: UFC1 is an essential catalytic component of ufmylation; the process annotation is well supported. Supporting Evidence: file:human/UFC1/UFC1-uniprot.txt E2-like enzyme which specifically catalyzes the second step in ufmylation |
| GO:0005515 protein binding | IPI PMID:25902260 Autism and intellectual disability-associated KIRREL3 intera... | REMOVE | Summary: IntAct interaction with KIRREL3 (Q8IZU9) from an autism/intellectual-disability interactome screen. Bare protein binding is uninformative and this partner is not part of the ufmylation cascade. Reason: Bare GO:0005515 protein binding carries no functional information, so under the generic protein-binding policy this row is REMOVE. Removal does not mean the reported interaction is false; the summary and any supporting text keep it on record. |
| GO:0005515 protein binding | IPI PMID:32296183 A reference map of the human binary protein interactome. | REMOVE | Summary: Binary interactome (HuRI) interactions. Bare protein binding is uninformative. Reason: Bare GO:0005515 protein binding carries no functional information, so under the generic protein-binding policy this row is REMOVE. Removal does not mean the reported interaction is false; the summary and any supporting text keep it on record. |
| GO:0005515 protein binding | IPI PMID:32814053 Interactome Mapping Provides a Network of Neurodegenerative ... | REMOVE | Summary: Neurodegeneration interactome screen interaction. Bare protein binding is uninformative and the partner is not part of the cascade. Reason: Bare GO:0005515 protein binding carries no functional information, so under the generic protein-binding policy this row is REMOVE. Removal does not mean the reported interaction is false; the summary and any supporting text keep it on record. |
| GO:0005515 protein binding | IPI PMID:33961781 Dual proteome-scale networks reveal cell-specific remodeling... | REMOVE | Summary: BioPlex affinity-purification interaction with UFL1 (O94874), the cognate E3 ligase. This is a genuine cascade interaction, but the bare term is uninformative. Reason: Bare GO:0005515 protein binding carries no functional information, so under the generic protein-binding policy this row is REMOVE. Removal does not mean the reported interaction is false; the summary and any supporting text keep it on record. |
| GO:0005515 protein binding | IPI PMID:37595036 Mechanistic insights into the roles of the UFM1 E3 ligase co... | REMOVE | Summary: Interaction with UFL1 (O94874) reported in the mechanistic study of the UFM1 E3 ligase complex. Genuine cascade interaction; bare term is uninformative. Reason: Bare GO:0005515 protein binding carries no functional information, so under the generic protein-binding policy this row is REMOVE. Removal does not mean the reported interaction is false; the summary and any supporting text keep it on record. |
| GO:0005515 protein binding | IPI PMID:40205054 Multimodal cell maps as a foundation for structural and func... | REMOVE | Summary: Multimodal cell-maps interaction with CDK5RAP3 (Q96JB5), a UREL-complex component. Bare protein binding is uninformative. Reason: Bare GO:0005515 protein binding carries no functional information, so under the generic protein-binding policy this row is REMOVE. Removal does not mean the reported interaction is false; the summary and any supporting text keep it on record. |
| GO:0032649 regulation of type II interferon production | IEA GO_REF:0000107 | KEEP AS NON CORE | Summary: Inferred from the mouse ortholog; ufmylation regulates innate-immune/interferon signaling, but a specific causal role of UFC1 in type II interferon production in human is not directly demonstrated here. Reason: Plausible electronic transfer reflecting ufmylation's role in immune signaling; peripheral to UFC1's catalytic function. Supporting Evidence: file:human/UFC1/UFC1-uniprot.txt interferon response |
| GO:0032649 regulation of type II interferon production | ISS GO_REF:0000024 | KEEP AS NON CORE | Summary: Sequence-similarity transfer from the mouse ortholog for the same immune-signaling role. Reason: Same rationale as the IEA annotation; non-core, plausible by orthology. Supporting Evidence: file:human/UFC1/UFC1-uniprot.txt interferon response |
| GO:0061657 UFM1 conjugating enzyme activity | IDA PMID:34588452 Structural basis for UFM1 transfer from UBA5 to UFC1. | ACCEPT | Summary: Structural/biochemical demonstration of UFM1 transfer from UBA5 to UFC1, establishing UFC1's E2 conjugating activity directly. Reason: Direct experimental evidence for the core E2 function; structures show activation of the UFC1 active site upon UBA5 binding. Supporting Evidence: file:human/UFC1/UFC1-uniprot.txt Accepts the ubiquitin-like modifier UFM1 from the E1 enzyme UBA5 and forms an intermediate with UFM1 via a thioester linkage |
| GO:0071569 protein ufmylation | IDA PMID:34588452 Structural basis for UFM1 transfer from UBA5 to UFC1. | ACCEPT | Summary: Direct evidence that UFC1 participates in ufmylation via UFM1 transfer. Reason: Well-supported process annotation for the cascade E2. Supporting Evidence: file:human/UFC1/UFC1-uniprot.txt E2-like enzyme which specifically catalyzes the second step in ufmylation |
| GO:0061657 UFM1 conjugating enzyme activity | IMP PMID:37036982 RPL26/uL24 UFMylation is essential for ribosome-associated q... | ACCEPT | Summary: Functional (mutant/knockout) evidence that UFC1 conjugating activity is required for RPL26/uL24 ufmylation and ER ribosome-associated quality control. Reason: Direct functional support for the core E2 activity in the physiological RQC context. Supporting Evidence: PMID:37036982 RQC-dependent degradation of ER-APs strictly requires conjugation of the |
| GO:0071569 protein ufmylation | IMP PMID:37036982 RPL26/uL24 UFMylation is essential for ribosome-associated q... | ACCEPT | Summary: UFC1 is required for ufmylation of 60S ribosomes at the ER, supporting the process annotation. Reason: Functional evidence ties UFC1 to ER ribosome ufmylation. Supporting Evidence: PMID:37036982 UFMylation of translocon-bound 60S subunits modulates the RTJ |
| GO:0061657 UFM1 conjugating enzyme activity | IDA PMID:36121123 A non-canonical scaffold-type E3 ligase complex mediates pro... | ACCEPT | Summary: Demonstration that the UFL1/DDRGK1 scaffold-type E3 activates UFC1 for aminolysis (UFM1 transfer); UFC1 Lys-108 is required. Reason: Direct biochemical support for the E2 conjugating activity within the non-canonical E2-E3 mechanism. Supporting Evidence: PMID:36121123 We show that UFL1/UFBP1 utilizes a scaffold-type E3 ligase mechanism that activates the UFM1-conjugating E2 enzyme, UFC1, for aminolysis. |
| GO:0061657 UFM1 conjugating enzyme activity | IDA PMID:38383789 The UFM1 E3 ligase recognizes and releases 60S ribosomes fro... | ACCEPT | Summary: Structures of the UFC1-UFL1-UFM1-DDRGK1 complex and ribosome ufmylation assays establish UFC1's conjugating activity in the context of 60S recycling. Reason: Direct structural and functional support for the core E2 activity. Supporting Evidence: PMID:38383789 the ubiquitin-like protein UFM1 on the 60S ribosomal subunit protein RPL26 |
| GO:0071569 protein ufmylation | IMP PMID:30626644 Ribosomal protein RPL26 is the principal target of UFMylatio... | ACCEPT | Summary: UFC1 is required for ufmylation; RPL26 identified as the principal target. Reason: Functional support for UFC1's role in ufmylation. Supporting Evidence: PMID:30626644 Ribosomal protein RPL26 is the principal target of UFMylation |
| GO:0071569 protein ufmylation | IDA PMID:36121123 A non-canonical scaffold-type E3 ligase complex mediates pro... | ACCEPT | Summary: Direct evidence that UFC1, activated by the scaffold E3, ufmylates substrate. Reason: Supports the process annotation for the E2. Supporting Evidence: PMID:36121123 using in vitro UFMylation assays containing UBA5, UFC1, and UFM1 and ATP PMID:36121123 the UFL1/UFBP1 complex is an active ligase as evidenced by UFL1 autoUFMylation and the formation of multiple UFMylated products |
| GO:0071569 protein ufmylation | IDA PMID:38383789 The UFM1 E3 ligase recognizes and releases 60S ribosomes fro... | ACCEPT | Summary: Direct evidence for UFC1-dependent ufmylation of 60S ribosomes. Reason: Supports the process annotation. Supporting Evidence: PMID:38383789 post-translational attachment of UFM1 to the lysine residues of target proteins, UFMylation, is catalysed by an enzymatic cascade of E1 (UBA5), E2 (UFC1) and E3 (UFL1) enzymes PMID:38383789 we aimed to trap UREL in a state in which it is positioned to transfer UFM1 from the E2 (UFC1) onto RPL26 |
| GO:0034976 response to endoplasmic reticulum stress | IMP PMID:32160526 A genome-wide ER-phagy screen highlights key roles of mitoch... | KEEP AS NON CORE | Summary: Genome-wide ER-phagy screen implicating ER-resident ufmylation (including the E2 step) in ER stress responses. Reason: Valid downstream process; non-core relative to the E2 catalytic activity. Supporting Evidence: file:human/UFC1/UFC1-uniprot.txt response to DNA damage, interferon response or reticulophagy |
| GO:0061709 reticulophagy | IMP PMID:32160526 A genome-wide ER-phagy screen highlights key roles of mitoch... | KEEP AS NON CORE | Summary: ER-phagy screen implicating the ufmylation pathway (UFC1 E2 step) in reticulophagy. Reason: Valid downstream process; non-core. Supporting Evidence: file:human/UFC1/UFC1-uniprot.txt reticulophagy |
| GO:0071569 protein ufmylation | IMP PMID:32160526 A genome-wide ER-phagy screen highlights key roles of mitoch... | ACCEPT | Summary: ER-phagy screen confirms UFC1 involvement in ufmylation. Reason: Supports the process annotation. Supporting Evidence: file:human/UFC1/UFC1-uniprot.txt E2-like enzyme which specifically catalyzes the second step in ufmylation |
| GO:0005515 protein binding | IPI PMID:30886146 UFL1 promotes histone H4 ufmylation and ATM activation. | REMOVE | Summary: Interaction with UFL1 (O94874) reported in the histone H4 ufmylation/ATM study. Genuine cascade partner; bare term uninformative. Reason: Bare GO:0005515 protein binding carries no functional information, so under the generic protein-binding policy this row is REMOVE. Removal does not mean the reported interaction is false; the summary and any supporting text keep it on record. |
| GO:0061657 UFM1 conjugating enzyme activity | IDA PMID:15071506 A novel protein-conjugating system for Ufm1, a ubiquitin-fol... | ACCEPT | Summary: Founding paper identifying UFC1 as the E2 that accepts activated UFM1 from UBA5 via thioester linkage; defines the catalytic Cys. Reason: Original direct demonstration of the core E2 UFM1-conjugating activity. Supporting Evidence: PMID:15071506 Activated Ufm1 is then transferred to its cognate |
| GO:0005515 protein binding | IPI PMID:29868776 Biallelic UFM1 and UFC1 mutations expand the essential role ... | REMOVE | Summary: Interactions reported in the disease study (UFM1 P61960 among partners). Bare term uninformative, but reflects a cascade interaction. Reason: Bare GO:0005515 protein binding carries no functional information, so under the generic protein-binding policy this row is REMOVE. Removal does not mean the reported interaction is false; the summary and any supporting text keep it on record. |
| GO:0007420 brain development | IMP PMID:29868776 Biallelic UFM1 and UFC1 mutations expand the essential role ... | KEEP AS NON CORE | Summary: Biallelic UFC1 variants (R23Q, T106I) that impair thioester formation and ufmylation cause a neurodevelopmental disorder, establishing an essential role of ufmylation in brain development. Reason: A genuine, disease-supported physiological role, but a pleiotropic developmental outcome rather than UFC1's core molecular function. Supporting Evidence: file:human/UFC1/UFC1-uniprot.txt Biallelic UFM1 and UFC1 mutations expand the essential role of ufmylation in brain development |
| GO:0071569 protein ufmylation | IMP PMID:29868776 Biallelic UFM1 and UFC1 mutations expand the essential role ... | ACCEPT | Summary: Disease variants decrease ufmylation, functionally implicating UFC1 in the process. Reason: Supports the process annotation with patient-variant evidence. Supporting Evidence: file:human/UFC1/UFC1-uniprot.txt decreased protein ufmylation |
| GO:1990592 protein K69-linked ufmylation | IDA PMID:25219498 Modification of ASC1 by UFM1 is crucial for ERΞ± transactivat... | KEEP AS NON CORE | Summary: UFC1 participates in UFM1 conjugation; UFM1 chains can be linked through Lys-69. This specific linkage-type process is part of ufmylation chemistry. Reason: A specific sub-aspect of ufmylation (chain linkage type); valid but a narrow process annotation relative to the core E2 activity. The cached abstract does not mention UFC1 or the Lys-69 linkage, so this defers to the curator's reading of the full text of this polyufmylation study. Supporting Evidence: PMID:25219498 Polyufmylation of ASC1 enhanced association of p300, SRC1, and ASC1 at promoters of ERΞ± target genes. |
| GO:0070062 extracellular exosome | HDA PMID:19056867 Large-scale proteomics and phosphoproteomics of urinary exos... | KEEP AS NON CORE | Summary: Detected in an extracellular-vesicle proteome. The protein is plausible EV content, but this is not where it functions. Reason: Cytosolic E2 enzyme. Cytosolic protein (GO cytosol or cytoplasm annotation); cytosolic proteins, including abundant enzymes and cytoskeletal proteins, are expected and often promiscuous EV contents (MISEV2018 (PMID:30637094) category 2b). True, but not its core location. (Manual re-review for OMICS_EVIDENCE, 2026-10-10; previous action: MARK_AS_OVER_ANNOTATED.) Supporting Evidence: PMID:19056867 Here, we used LC-MS/MS to profile the proteome of human urinary exosomes. |
| GO:0034976 response to endoplasmic reticulum stress | IDA PMID:23152784 Transcriptional regulation of the Ufm1 conjugation system in... | KEEP AS NON CORE | Summary: The UFM1 conjugation system is transcriptionally up-regulated upon ER stress, consistent with a role in the ER stress response. Reason: Valid pathway context; non-core relative to catalytic activity. Supporting Evidence: PMID:23152784 we found that the Ufm1 system was transcriptionally up-regulated by disturbance of the ER homeostasis and inhibition of vesicle trafficking. |
| GO:0071569 protein ufmylation | IMP PMID:23152784 Transcriptional regulation of the Ufm1 conjugation system in... | ACCEPT | Summary: UFC1 is part of the UFM1 conjugation system implicated in this study. Reason: Supports the process annotation. The study knocked down Ufc1 among the Ufm1 components; this defers to the curator's reading of the full text. Supporting Evidence: PMID:23152784 Ufc1 shRNA (GCATCACACTTAACTCATCTA) PMID:23152784 we present the evidence for involvement of RCAD/Ufl1, a putative Ufm1-specific E3 ligase, and its binding partner C53/LZAP protein in ufmylation of endogenous Ufm1 targets. file:human/UFC1/UFC1-uniprot.txt E2-like enzyme which specifically catalyzes the second step in ufmylation |
| GO:0005515 protein binding | IPI PMID:20018847 A novel type of E3 ligase for the Ufm1 conjugation system. | REMOVE | Summary: Interaction with UFL1 (O94874) from the paper identifying the UFM1 E3 ligase. Genuine cascade interaction; bare term uninformative. Reason: Bare GO:0005515 protein binding carries no functional information, so under the generic protein-binding policy this row is REMOVE. Removal does not mean the reported interaction is false; the summary and any supporting text keep it on record. |
| GO:0071569 protein ufmylation | IDA PMID:15071506 A novel protein-conjugating system for Ufm1, a ubiquitin-fol... | ACCEPT | Summary: Founding biochemical demonstration of the UFM1 conjugation system in which UFC1 is the E2. Reason: Direct evidence for the process; UFC1 is the cascade E2. Supporting Evidence: PMID:15071506 Activated Ufm1 is then transferred to its cognate |
Loading supporting contentβ¦
Download this section (compressed HTML)Q: Beyond RPL26/uL24, what is the full physiological substrate repertoire of UFC1-dependent ufmylation, and which substrates are direct E2 products versus E3-determined?
Q: How do the disease variants R23Q and T106I mechanistically reduce thioester formation, and does residual activity correlate with phenotype severity?
Experiment: Reconstitute the UBA5-UFC1-UFL1/DDRGK1 cascade in vitro with purified components and 60S ribosomes to quantify the kinetic contribution of UFC1 active-site activation to RPL26 ufmylation.
Experiment: CRISPR knock-in of UFC1 catalytic (C116S) or disease (R23Q/T106I) alleles in cells followed by ribosome-ufmylation and ER-RQC reporter assays to test the requirement of E2 activity for 60S recycling.
Loading supporting contentβ¦
Download this section (compressed HTML)Loading supporting contentβ¦
Download this section (compressed HTML)Loading supporting contentβ¦
Download this section (compressed HTML)