Toll-like receptor of the TLR11/TLR12 pair, found in rodents and in some other mammals including horses and lemurs but absent from the human genome. It has the canonical TLR architecture, a leucine-rich-repeat ectodomain, a single transmembrane segment and a cytoplasmic TIR domain, and behaves as an intracellular rather than a cell-surface receptor, being delivered to the endosomal/endolysosomal system by the trafficking chaperone UNC93B1 and engaging its ligand there at acidic pH. Its characterised ligand is profilin from apicomplexan parasites, notably Toxoplasma gondii, which the receptor ectodomain binds directly. The protein forms homodimers and also heterodimers with its close paralogue, and the pair acts together in dendritic cells and macrophages to drive IL-12 production in response to parasite profilin, with the paralogue supplying MyD88 recruitment. Downstream of the receptor pair the IL-12 response of dendritic cells was shown to require MyD88 and the transcription factor IRF8 and not to require NF-kappa-B1 or NF-kappa-B2, while a separate study reported NF-kappa-B activation in macrophages and plasmacytoid dendritic cells, so the transcriptional route is cell-type dependent. Through this route the receptor contributes to host resistance to Toxoplasma infection. The literature names of the two paralogues are interchanged relative to the MGI and UniProt gene symbols, so published work on "TLR12" refers to this protein.
| GO Term | Evidence | Action | Reason |
|---|---|---|---|
| GO:0002224 toll-like receptor signaling pathway | IBA GO_REF:0000033 | ACCEPT | Summary: The protein is a bona fide TLR that signals to IL-12 induction on ligand engagement, through MyD88 and IRF8, so the family-level pathway term is correct. Reason: The PAINT node placement is sound: this is a TIR-domain LRR receptor acting in a MyD88/UNC93B1-dependent TLR cascade with its paralogue, demonstrated in dendritic cells and macrophages. GO also has numbered children for this pair (GO:0034170 toll-like receptor 11 signaling pathway, GO:0034174 toll-like receptor 12 signaling pathway), and one of them describes this gene product exactly, but the two terms are named after the receptors as the literature names them, and the literature names of Q6R5P0 and Q6QNU9 are interchanged relative to the MGI/UniProt symbols. Assigning a numbered child would assert a nomenclature resolution that GO and MGI have not made, so the unnumbered parent is kept and the question raised. Supporting Evidence: PMID:23246311 TLR11 and TLR12 act as obligate heterodimers to activate NF-ΞΊB and produce IL-12 in response to TgPRF PMID:24078692 our study uncovered a MyD88 and IRF8-dependent but NF-ΞΊB independent pathway in DCs for the induction of IL-12 |
| GO:0005515 protein binding | IPI PMID:23101627 A mouse model of Salmonella typhi infection. | UNDECIDED | Summary: Bare protein binding recording an interaction with Salmonella flagellin FliC; uninformative as a molecular function, and the receptor assayed in the cited paper is most likely the paralogue. Reason: Two separate problems. First, GO:0005515 carries no functional information; if the interaction stands it should be expressed as pattern recognition receptor activity rather than generic binding. Second, the cited paper reports flagellin binding by the receptor it calls TLR11, and on the sequence evidence the protein called TLR11 in this literature is Q6QNU9 (MGI Tlr12), not this entry. UniProt states that the nomenclature of the pair is routinely inverted, and independent cloning primers in two other papers place the TLR11 N-terminus (MGRYWLL) on Q6QNU9 and the TLR12 N-terminus (MPRMER) on Q6R5P0. IntAct nonetheless placed this interaction on Q6R5P0. Because this reviewer cannot see how the identity was assigned, and repository policy forbids overturning an experimental annotation on paralog-attribution grounds, it is left undecided for MGI and IntAct to resolve. Supporting Evidence: PMID:23101627 Flagellin binds TLR11 and induces innate responses in mice independent of TLR5. PMID:24078692 AAGTCGACGCCACCATGCCCCGCATGGAGCG |
| GO:0005886 plasma membrane | IBA GO_REF:0000033 | MODIFY | Summary: This receptor acts in endosomes, not at the plasma membrane; the inherited location comes from the surface-TLR donors of the PAINT node. Reason: The donor set is dominated by cell-surface receptors (TLR1, TLR2, TLR4, TLR5, TLR6, Drosophila Toll), so the node transferred a property that is not conserved in this branch. Experimentally the receptor is guided to the endolysosomal system by UNC93B1 and engages profilin there at acidic pH, and the two studies that examined the pair directly concluded that both are endosomal TLRs. Endosome is proposed rather than a finer child because the published evidence distinguishes a resting ER pool from an activated endolysosomal pool without resolving a single compartment. Propagation Review Root cause: PROPAGATION BAD Failure modes: COMPARTMENT OR COMPLEX MISMATCH Sources checked: PANTHER:PTN002808045 SUPPORTS SOURCE BUT NOT TARGET Ancestral node placed on a set of donors that are cell-surface receptors (TLR1, TLR2, TLR4, TLR5, TLR6 and Drosophila Toll); the plasma-membrane location is sound for them and does not transfer to this UNC93B1-dependent intracellular branch. Proposed replacements: endosome Supporting Evidence: PMID:23290966 both TLR11 and TLR12 are endosomal TLRs and act as heterodimers in the recognition of Toxoplasma molecules PMID:23246311 suggesting that TLR12 also is guided to the endolysosomal system by Unc-93B1 |
| GO:0007165 signal transduction | IEA GO_REF:0000002 | KEEP AS NON CORE | Summary: True but generic; the TIR-domain-to-GO mapping gives the top-level process of which the annotated TLR pathway is a descendant. Reason: Correct, since the protein does transduce a signal, but uninformative next to GO:0002224, which is annotated on the same gene. Retained rather than removed because the InterPro mapping is sound for a TIR-domain protein. |
| GO:0009617 response to bacterium | IMP PMID:15001781 A toll-like receptor that prevents infection by uropathogeni... | UNDECIDED | Summary: Mutant-phenotype annotation from the uropathogenic E. coli study, but both the cited paper's receptor and the allele in the WITH field belong to the paralogue on the available sequence evidence. Reason: The knockout in the cited paper is allele MGI:3045751, which MGI records as Tlr12<tm1Gho> with the note that every reference identifies it as a Tlr11 allele while all associated sequence information indicates it is an allele of Tlr12; and UniProt cites PMID:15001781 under Q6QNU9 (Tlr12) for both FUNCTION and DISRUPTION PHENOTYPE, not under this entry. So the bacterium-response phenotype most likely belongs to the paralogue, and there is no independent evidence that Q6R5P0 itself responds to bacteria; its established ligand is apicomplexan profilin. This is not removed, because an experimental annotation should not be overturned on paralog-attribution grounds by a reviewer who cannot see the curator's full reasoning. It is flagged so that MGI and GO can resolve the pair's identity once and propagate the answer to both entries. Supporting Evidence: PMID:15001781 Cells expressing TLR11 fail to respond to known TLR ligands but instead respond PMID:24078692 AAGTCGACGCCACCATGGGCCGCTACTGGCT |
| GO:0016020 membrane | IEA GO_REF:0000044 | KEEP AS NON CORE | Summary: Correct at the generic level for a single-pass type I membrane protein. Reason: True but uninformative; the informative location for this receptor is the endosome/endolysosome, proposed above as the replacement for the plasma-membrane row. |
| GO:0038023 signaling receptor activity | IBA GO_REF:0000033 | MODIFY | Summary: The receptor binds a microbial molecular pattern (apicomplexan profilin) directly, so the specific pattern recognition receptor activity term applies. Reason: GO:0038023 is correct but is the generic parent. Raetz et al. showed that both members of the pair interact directly with Toxoplasma profilin in a pH-dependent manner, which is exactly the combining with a pathogen-associated molecular pattern to initiate an innate immune response that GO:0038187 defines. GO:0038187 is also the conventional MF for characterised TLRs (human TLR2, TLR5 and TLR9 each carry it by IDA), so this brings the entry into line with the family. The recognition claim does not depend on which paralogue carries which literature name, because both were assayed side by side in the same experiments. Propagation Review Root cause: TERM SCOPING PROBLEM Failure modes: GRANULARITY MISMATCH Sources checked: PANTHER:PTN002808045 SUPPORTS TRANSFER The node assertion is correct; it is simply the generic parent, and direct profilin binding by this receptor supports the specific pattern recognition receptor activity child. Proposed replacements: pattern recognition receptor activity Supporting Evidence: PMID:24078692 Additionally, both TLR11 and TLR12 are not only capable of forming a heterodimeric complex but also directly interacts with T. gondii profilin. PMID:23246311 TLR11 and TLR12 act as obligate heterodimers to activate NF-ΞΊB and produce IL-12 in response to TgPRF |
| GO:0051707 response to other organism | IEA GO_REF:0000117 | KEEP AS NON CORE | Summary: Correct at a very general level; the specific response is to a protozoan parasite. Reason: The ARBA model's claim is true, in that the receptor functions in the response to another organism, but the informative term is the proposed GO:0042832 defense response to protozoan, a descendant of this one. |
| GO:0042832 defense response to protozoan | IMP PMID:23246311 Recognition of profilin by Toll-like receptor 12 is critical... | NEW | Summary: Loss of this receptor impairs IL-12 production and host resistance to Toxoplasma gondii, the response that its profilin-recognition activity initiates. Reason: Q6R5P0 is the receptor called TLR12 in the Koblansky and Raetz papers (the cloned open reading frame is NP_991388, this entry's RefSeq, with this entry's 30-residue signal peptide), and those papers show that its loss abolishes the IL-12 response of dendritic cells and macrophages to Toxoplasma profilin and reduces host resistance to the parasite. Participation is direct rather than permissive: the receptor ectodomain binds the profilin PAMP itself and dimerisation of the receptor pair is the step that initiates the downstream cascade, so this gene product performs recognition work within the process. The comparator check supports the proposal rather than undermining it: the paralogue Q6QNU9 already carries GO:0042832 by IMP from the mirror-image paper on the same parasite, and characterised TLRs are routinely annotated to the defense-response term for the class of pathogen they sense. Supporting Evidence: PMID:23246311 TLR11 and TLR12 act as obligate heterodimers to activate NF-ΞΊB and produce IL-12 in response to TgPRF PMID:23246311 Analysis of the putative open reading frame of TLR12 (Gen-Bank accession number NP_991388.1) PMID:24078692 Thus, these experiments revealed that, in addition to TLR11 and MyD88, TLR12 is required for the induction of IL-12 by DCs in response to T |
Loading supporting contentβ¦
Download this section (compressed HTML)Q: Which transcription factors carry the signal from this receptor pair? The IL-12 response of dendritic cells to profilin was found to require MyD88 and IRF8 and not NF-kappa-B1 or NF-kappa-B2, whereas NF-kappa-B activation was reported in macrophages and plasmacytoid dendritic cells, so whether an NF-kappa-B-dependent branch should be annotated at all, and in which cell type, is unsettled.
Q: Which UniProt entry does each of GO:0034170 (toll-like receptor 11 signaling pathway) and GO:0034174 (toll-like receptor 12 signaling pathway) describe? Both term names follow the literature receptor names, and those names are inverted relative to the MGI and UniProt symbols, so neither numbered child can be safely annotated until GO and MGI agree a mapping.
Q: Should MGI's GO:0009617 annotation on Tlr11 (IMP, PMID:15001781, WITH allele MGI:3045751) be moved to Tlr12, given that MGI records that allele as Tlr12<tm1Gho> and notes that the sequence evidence points to Tlr12? The same question applies in reverse to the IntAct flagellin interaction placed on Q6R5P0.
Q: Does Q6R5P0 recognise any ligand other than apicomplexan profilin? Both paralogues were reported not to respond to the standard panel of TLR agonists, and the profilin work was done entirely with Toxoplasma.
Q: Is the profilin-binding surface on Q6R5P0, on its paralogue, or shared across the heterodimer interface? Direct interaction of both receptors with profilin is reported, but no structure or mapped binding site exists for either.
Experiment: Re-derive the identity of the two receptors experimentally and publicly: sequence the widely shared knockout lines and the common expression plasmids (including the InvivoGen constructs used in several papers) and map each against Q6R5P0/NP_991388 and Q6QNU9/NP_991392, then publish the mapping so that MGI, UniProt and GO can converge.
Hypothesis: The literature names of TLR11 and TLR12 are interchanged relative to the database symbols; one public sequence-level mapping would let the annotations, including the two numbered GO pathway terms, be assigned correctly.
Type: sequence verification of reagents
Experiment: Determine a structure of the Q6R5P0 ectodomain with Toxoplasma profilin, alone and with the paralogue ectodomain, and test point mutants of the predicted contact residues for profilin binding, dimerisation and IL-12 induction in primary dendritic cells.
Hypothesis: Profilin is bound at a composite site across the heterodimer, which would explain why both receptors are required although only one recruits MyD88.
Type: structural biology with structure-guided mutagenesis
Experiment: Test whether Q6R5P0 responds to bacterial ligands at all, by stimulating cells expressing only this receptor, with the paralogue as a control, with purified Salmonella and uropathogenic E. coli flagellin and with lysates of uropathogenic E. coli, reading NF-kappa-B activation and IL-6 and IL-12 output.
Hypothesis: The bacterium-response and flagellin-binding annotations now on this entry belong to the paralogue; a side-by-side assay with sequence-verified constructs would settle it.
Type: receptor activation assay
Loading supporting contentβ¦
Download this section (compressed HTML)Loading supporting contentβ¦
Download this section (compressed HTML)Loading supporting contentβ¦
Download this section (compressed HTML)