Plant & Pennycress (*Thlaspi arvense*) `miRNA -> Target` Datasets

Plant & Pennycress (Thlaspi arvense) miRNA -> Target Datasets

This directory contains parsed, cross-mapped public plant miRNA -> target datasets and pennycress (Thlaspi arvense, taxon 13288, assembly T_arvense_v2 / GCA_911865555.2, UniProt proteome UP000836841) miRNA locus and target tables supporting the THLAR_OILSEED project and plant small RNA gene reviews.

1. Files in projects/THLAR_OILSEED/mirna_targets/

File Rows Description
thlar_mirna_loci_72.tsv 72 All 72 ShortStack-curated pennycress miRNA loci from Nunn et al. (2022) (Plant Biotechnol. J. 20:944–963, PMID:34990041 / PMC9055812, Supplementary Figure 9 & Supplementary Info 1): 53 conserved loci across 25 families + 19 novel species-specific Cluster_... loci, with heatmap rank, conservation scope, mature 5'->3' sequence, tissue expression profile (Pollen / Inflorescence / Root / Leaf), and pennycress CDS target counts.
thlar_mirna_targets.tsv 88 88 high-confidence conserved miRNA target sites across 73 unique TAV2_LOCUS pennycress genes (T_arvense_v2 CDSs), cross-mapped to Tarvense_... gene IDs, NCBI CAH... protein IDs, 73/73 UniProtKB A0AAU9... accessions, 9-tissue mRNA-seq TPM (pbi13775-sup-0002-DataS1.tsv), Allen target scores, cleavage site predictions, and Arabidopsis thaliana ortholog modules.
tardb_ath_degradome.tsv 168 Gene-level deduplicated degradome/PARE-validated Arabidopsis thaliana miRNA -> target cleavage interactions (151 unique AGI target genes across 168 (miRNA_family, Target_Gene_AGI) pairs; Allen score $\le 2.0$, best CleaveLand $p$-value, base-pairing alignment; full 413-row transcript-level table in scratch) parsed from TarDB (http://www.biosequencing.cn/TarDB/, Liu et al. 2021, PMID:33980168).
goa_tair_mirna_annotations.tsv 54 Non-IEA GO annotations for A. thaliana miRNA genes (goa_arabidopsis_rna.gaf.gz) and protein-coding miRNA pathway / target genes (tair.gaf.gz), documenting both experimental RNAcentral has_input annotations and substrate-vs-actor mis-annotations (CSD1, CSD2, PXMT1).

Additional Large Brassicaceae & Literature Datasets

Additional multi-species and literature corpora surveyed for this dataset include:
- tardb_brassicaceae_conserved.tsv (11,749 rows across 6 Brassicaceae species: A. thaliana ath 3,510; A. lyrata aly 2,364; Capsella rubella cru 790; Eutrema salsugineum esa 1,133 [Lineage II]; Brassica rapa bra 3,520 [Lineage II]; B. oleracea bol 432 [Lineage II]).
- pmiren_ath_targets.tsv (5,876 rows across 455 A. thaliana miRNAs from PmiREN 3.0/3.1, including 219 degradome-validated rows with T-plot PDF URLs).
- pmiren_esa_targets.tsv (774 rows in Eutrema salsugineum, the closest Lineage II relative of Thlaspi arvense in PmiREN).
- pmiren_literature_plant_relations.tsv (1,309 rows of literature-curated plant miRNA -> target relations with PMIDs, DOIs, and verbatim supporting sentences from PmiREN 3.1 miRNA_QA_dataset_v1.zip, Figshare DOI 10.6084/m9.figshare.34024083).

2. Summary of the 72 Pennycress miRNA Loci (Nunn et al. 2022)

Nunn et al. (2022) (Plant Biotechnol. J. 20:944–963, PMID:34990041 / PMC9055812) sequenced sRNAs across 4 pennycress tissues (Pollen, Inflorescence, Root, and Rosette Leaf) and annotated 74 candidate miRNA loci with ShortStack v3.8.5 against the T_arvense_v2 reference genome, confirming 72 bona fide miRNA loci (after rejecting Cluster_11184 and Cluster_1133):

3. Conserved miRNA -> Target Regulatory Modules in Pennycress & Relevance to THLAR_OILSEED

miRNA Family Pennycress Loci Pennycress Target Genes (TAV2_LOCUS / UniProtKB) Arabidopsis Orthologs Biological & Oilseed Domestication Role
miR156 / miR157 10 loci (miR156 x8, miR157 x2) 7 SBP-box TFs: TAV2_LOCUS686 (A0AAU9R598), TAV2_LOCUS8053 (A0AAU9RQH6), TAV2_LOCUS13245 (A0AAU9S4J6), TAV2_LOCUS687 (A0AAU9R5F0), TAV2_LOCUS16487 (A0AAU9SHU7), TAV2_LOCUS22078 (A0AAU9SUB7), TAV2_LOCUS17655 (A0AAU9SHM7) SPL2/3/4/5/6/9/10/11/13/15 Controls vegetative-to-reproductive phase transition, flowering time, silique maturation, and seed oil/mucilage partitioning (miR156-SPL-miR172-AP2/WRI1 cascade).
miR172 3 loci (miR172, .1, .2) 6 AP2/ERF TFs: TAV2_LOCUS18783 (A0AAU9SIR0), TAV2_LOCUS23360 (A0AAU9T1Q2), TAV2_LOCUS13511 (A0AAU9S9H0), TAV2_LOCUS15398 (A0AAU9SFF7), TAV2_LOCUS5241 (A0AAU9RHM9), TAV2_LOCUS12280 (A0AAU9S8K1) AP2, TOE1, TOE2, TOE3, SMZ, SNZ Represses AP2-clade floral repressors; AP2 negatively regulates seed size, seed coat mucilage, and embryo oil accumulation (WRI1-linked lipid synthesis; see projects/THLAR_OILSEED.md).
miR395 1 locus (miR395) ATP sulfurylase TAV2_LOCUS7508 (A0AAU9RRK7, peak TPM 1655.64 in seed_pod) & sulfate transporters TAV2_LOCUS14532 (A0AAU9S8I4), TAV2_LOCUS21835 (A0AAU9SVI0) APS1/3/4 (AT3G22890, AT5G43780), SULTR2;1 (AT5G10180) Directs sulfate assimilation (PAPS synthesis) and root-to-pod sulfate translocation required for glucosinolate (sinigrin) biosynthesis in pennycress seeds (AOP2/GTR1/GTR2 module).
miR396 2 loci (miR396, miR396.1 / Cluster_18198) 7 Growth-Regulating Factors (GRF): TAV2_LOCUS16031 (A0AAU9SIN8, peak TPM 93.5 in green_seed), TAV2_LOCUS24911 (A0AAU9T2T6, 42.2 in green_seed), TAV2_LOCUS13594 (A0AAU9S7K7, 27.4 in green_seed), TAV2_LOCUS13892 (A0AAU9S9E5), TAV2_LOCUS23382 (A0AAU9T6Q2), TAV2_LOCUS19183 (A0AAU9SNP5), TAV2_LOCUS11916 (A0AAU9S2D3) GRF1/2/3/4/7/8/9 Canonical 1-nt bulge cleavage site (CCGTTCAAGAAAGCCTGTGGAA); major regulator of embryo cell proliferation, seed size, and seed oil content in Brassicaceae oilseeds.
miR397 1 locus (miR397) 2 Laccases: TAV2_LOCUS14099 (A0AAU9S9S2, peak TPM 202.75 in seed_pod) & TAV2_LOCUS22308 (A0AAU9SLN0) LAC2, LAC4/IRX12, LAC17 Regulates seed pod and seed coat lignin polymerization, pod shatter resistance (IND pathway), and seed coat permeability/dormancy (TT module).
miR160 / miR167 / miR393 6 loci (miR160 x3, miR167 x2, miR393 x1) ARF10/16/17: TAV2_LOCUS15436 (A0AAU9SP38), TAV2_LOCUS19535 (A0AAU9T051), TAV2_LOCUS13658 (A0AAU9S5Q0), TAV2_LOCUS23883 (A0AAU9T4H6), TAV2_LOCUS4572 (A0AAU9RG42); ARF6/8: TAV2_LOCUS16836 (A0AAU9SGH2), TAV2_LOCUS23322 (A0AAU9T5K7); TIR1/AFB: TAV2_LOCUS4099 (A0AAU9RGU5), TAV2_LOCUS16707 (A0AAU9SBX4), TAV2_LOCUS7969 (A0AAU9RKX6), TAV2_LOCUS18979 (A0AAU9SS77) ARF10/16/17, ARF6/8, TIR1/AFB1-3, bHLH77 Coordinates auxin perception and signaling across root architecture, flower/anther maturation, silique elongation, and seed dormancy.
miR164 / miR165 / miR166 10 loci (miR164 x3, miR165 x2, miR166 x5) 6 NAC TFs (TAV2_LOCUS5185 / A0AAU9RIK5, TAV2_LOCUS20428 / A0AAU9SW16, etc.) & 6 HD-ZIP III TFs (TAV2_LOCUS3035 / A0AAU9RAT6, TAV2_LOCUS21990 / A0AAU9SL93, etc.) CUC1/2, NAC1, ORE1; PHB, PHV, REV, ATHB-8/15 Controls carpel margin/septum fusion, ovule integument polarity, vascular patterning, and pod senescence.
miR162 2 loci (miR162, miR162.1) DCL1: TAV2_LOCUS3068 (A0AAU9RFA2, peak TPM 91.37 in inflorescence) DCL1 (AT1G01040) Negative feedback cleavage of DCL1 mRNA to maintain miRNA biogenesis homeostasis (modules/plant_mirna_biogenesis.yaml).
miR161 / miR390 3 loci (miR161 x1, miR390 x2) 6 PPR genes (TAV2_LOCUS6988 / A0AAU9RU77, TAV2_LOCUS5004 / A0AAU9RSC9, etc.) & 2 LRR genes (TAV2_LOCUS8390, TAV2_LOCUS8392) PPR-P clade, TAS3 Triggers secondary phasiRNA and TAS3 tasiRNA biogenesis (GO:0035278).

4. GOA / TAIR Curation Audit (goa_tair_mirna_annotations.tsv)

Inspection of goa_arabidopsis_rna.gaf.gz and tair.gaf.gz revealed two critical curation findings for plant miRNAs and their targets:

  1. Severe under-curation of experimentally validated plant miRNA targets in RNAcentral/GOA:
  2. Out of 892 miRNA annotations in goa_arabidopsis_rna.gaf.gz, 888 (99.5%) are uncurated IEA annotations to generic GO:0035195 (miRNA-mediated post-transcriptional gene silencing) and GO:0016442 (RISC complex) without target extensions.
  3. Only 2 Arabidopsis miRNAs have experimental (IDA) annotations in goa_arabidopsis_rna.gaf.gz: URS00005C2DB4_3702 (ath-miR390a/b-5p, with has_input(UniProtKB:Q1EBS9)) and URS00005F3E4D_3702 (ath-miR173-5p), both from PMID:34192539 for secondary siRNA (tasiRNA) biogenesis (GO:0035278).
  4. Substrate-vs-actor mis-annotation on protein-coding target genes in tair.gaf.gz:
  5. Three Arabidopsis protein-coding genes — CSD1 (AT1G08830), CSD2 (AT2G28190) (Cu/Zn superoxide dismutases cleaved by miR398, PMID:16861386), and PXMT1 (AT1G66700) (paraxanthine methyltransferase cleaved by miR163, PMID:21602291, PMID:26768601, PMID:28401908) — are annotated in tair.gaf.gz as involved_in GO:0035195 (miRNA-mediated post-transcriptional gene silencing, IEP).
  6. Per our GO curation guidelines (AGENTS.md, "Do not add what curators deliberately declined to add"), being the mRNA substrate cleaved by a miRNA-loaded RISC is not participation in the silencing machinery (GO:0035195). Those GO:0035195 rows on CSD1, CSD2, and PXMT1 should be marked REMOVE when reviewing those genes.